FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639678_at:

>probe:Drosophila_2:1639678_at:674:281; Interrogation_Position=1022; Antisense; CTCGTCGATCGACTGTTGTTATCTA
>probe:Drosophila_2:1639678_at:58:649; Interrogation_Position=1093; Antisense; TCAGACTCAGACCTGTTCCGAGTAT
>probe:Drosophila_2:1639678_at:707:677; Interrogation_Position=1168; Antisense; TAGTGTTTTCGTCGCACAAGCTTAA
>probe:Drosophila_2:1639678_at:236:343; Interrogation_Position=1187; Antisense; GCTTAATTCATTCTTCGTTCTTTTC
>probe:Drosophila_2:1639678_at:287:165; Interrogation_Position=1262; Antisense; AAATCATCAGTTTCCCATCTCTAAA
>probe:Drosophila_2:1639678_at:250:681; Interrogation_Position=688; Antisense; TTGATCTATTACTCCTTTCCGTACC
>probe:Drosophila_2:1639678_at:277:695; Interrogation_Position=703; Antisense; TTTCCGTACCTTAGCGTGGCCATAT
>probe:Drosophila_2:1639678_at:500:663; Interrogation_Position=776; Antisense; TAAAGGCATTGGTTCACTCGTCGGT
>probe:Drosophila_2:1639678_at:45:183; Interrogation_Position=812; Antisense; AAAACGTGGTCATCATAGCTGTGCA
>probe:Drosophila_2:1639678_at:597:355; Interrogation_Position=834; Antisense; GCACTGGATGTTGTTGGCCTACGGC
>probe:Drosophila_2:1639678_at:59:149; Interrogation_Position=878; Antisense; ACTATGCCTTTATGTGCTTGGTGCC
>probe:Drosophila_2:1639678_at:283:487; Interrogation_Position=931; Antisense; GTACGTTTCACGGATCCTGCCGAGT
>probe:Drosophila_2:1639678_at:698:19; Interrogation_Position=976; Antisense; ATTTGATGCGGCGACGTCCAGATGC
>probe:Drosophila_2:1639678_at:292:265; Interrogation_Position=994; Antisense; CAGATGCAAATTTTTCACGCCCGGG

Paste this into a BLAST search page for me
CTCGTCGATCGACTGTTGTTATCTATCAGACTCAGACCTGTTCCGAGTATTAGTGTTTTCGTCGCACAAGCTTAAGCTTAATTCATTCTTCGTTCTTTTCAAATCATCAGTTTCCCATCTCTAAATTGATCTATTACTCCTTTCCGTACCTTTCCGTACCTTAGCGTGGCCATATTAAAGGCATTGGTTCACTCGTCGGTAAAACGTGGTCATCATAGCTGTGCAGCACTGGATGTTGTTGGCCTACGGCACTATGCCTTTATGTGCTTGGTGCCGTACGTTTCACGGATCCTGCCGAGTATTTGATGCGGCGACGTCCAGATGCCAGATGCAAATTTTTCACGCCCGGG

Full Affymetrix probeset data:

Annotations for 1639678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720