FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639679_at:

>probe:Drosophila_2:1639679_at:467:335; Interrogation_Position=416; Antisense; GCTGCAACCGAACTGGCGAGGCCAT
>probe:Drosophila_2:1639679_at:337:19; Interrogation_Position=439; Antisense; ATTTGCCCCATGTGTCGGAACATAA
>probe:Drosophila_2:1639679_at:710:353; Interrogation_Position=471; Antisense; GCAGCCAGTGGCACATCGCTATAAG
>probe:Drosophila_2:1639679_at:470:685; Interrogation_Position=490; Antisense; TATAAGCTGCTGTCCAAGCGCCTGA
>probe:Drosophila_2:1639679_at:393:711; Interrogation_Position=549; Antisense; TTCACAGCATCTGAGTACGGACTCT
>probe:Drosophila_2:1639679_at:264:669; Interrogation_Position=564; Antisense; TACGGACTCTGAGCGACAGTACGAG
>probe:Drosophila_2:1639679_at:94:685; Interrogation_Position=628; Antisense; TATCCGGAGGTCACTAGCTCATGCA
>probe:Drosophila_2:1639679_at:512:87; Interrogation_Position=676; Antisense; AGTCCCTTCGAACGCAGACTAGCGA
>probe:Drosophila_2:1639679_at:323:285; Interrogation_Position=750; Antisense; CTGTCCCGAGGTGCGAGATCTGGTA
>probe:Drosophila_2:1639679_at:31:101; Interrogation_Position=790; Antisense; AGAGGCACTGTGACTCCTGGTCAAC
>probe:Drosophila_2:1639679_at:362:101; Interrogation_Position=828; Antisense; AGAGACTTTGAAGCGCTTATCCATC
>probe:Drosophila_2:1639679_at:69:469; Interrogation_Position=913; Antisense; GTTGAACATGTTGGCGCTGTTTGCC
>probe:Drosophila_2:1639679_at:150:177; Interrogation_Position=942; Antisense; AAACGCTGCTCCAATGCGTCCAAAA
>probe:Drosophila_2:1639679_at:72:135; Interrogation_Position=966; Antisense; ACGCCGCTCTAAAGTTATTCCTATG

Paste this into a BLAST search page for me
GCTGCAACCGAACTGGCGAGGCCATATTTGCCCCATGTGTCGGAACATAAGCAGCCAGTGGCACATCGCTATAAGTATAAGCTGCTGTCCAAGCGCCTGATTCACAGCATCTGAGTACGGACTCTTACGGACTCTGAGCGACAGTACGAGTATCCGGAGGTCACTAGCTCATGCAAGTCCCTTCGAACGCAGACTAGCGACTGTCCCGAGGTGCGAGATCTGGTAAGAGGCACTGTGACTCCTGGTCAACAGAGACTTTGAAGCGCTTATCCATCGTTGAACATGTTGGCGCTGTTTGCCAAACGCTGCTCCAATGCGTCCAAAAACGCCGCTCTAAAGTTATTCCTATG

Full Affymetrix probeset data:

Annotations for 1639679_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720