Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639683_at:

>probe:Drosophila_2:1639683_at:535:661; Interrogation_Position=1332; Antisense; TACAAAAGTACCTTGGCCGACACGT
>probe:Drosophila_2:1639683_at:118:579; Interrogation_Position=1346; Antisense; GGCCGACACGTGTTAAGCCAGTGAA
>probe:Drosophila_2:1639683_at:611:217; Interrogation_Position=1397; Antisense; AAGTAATTCTACATCTTCCACCGAG
>probe:Drosophila_2:1639683_at:441:163; Interrogation_Position=1438; Antisense; AAATTCTGTACAACTGGCTCGTGTA
>probe:Drosophila_2:1639683_at:429:571; Interrogation_Position=1453; Antisense; GGCTCGTGTAAGAGACCATCCTGTT
>probe:Drosophila_2:1639683_at:349:307; Interrogation_Position=1468; Antisense; CCATCCTGTTTTGCGAGACCATATA
>probe:Drosophila_2:1639683_at:506:271; Interrogation_Position=1498; Antisense; CATCTGTTTCGGTTTGAAGTCTGTC
>probe:Drosophila_2:1639683_at:29:493; Interrogation_Position=1543; Antisense; GTAAAAGCTGCGTCCTGTCAAACAG
>probe:Drosophila_2:1639683_at:729:501; Interrogation_Position=1604; Antisense; GTCGACCAAAGAGCGATCCCGATGT
>probe:Drosophila_2:1639683_at:16:451; Interrogation_Position=1618; Antisense; GATCCCGATGTACCATTCATGATTG
>probe:Drosophila_2:1639683_at:136:343; Interrogation_Position=1737; Antisense; TAAAGAACCGGATCCGAAGCCCACA
>probe:Drosophila_2:1639683_at:251:279; Interrogation_Position=1766; Antisense; CTACAACCAAATCCTCTTCTAAATC
>probe:Drosophila_2:1639683_at:697:565; Interrogation_Position=1816; Antisense; GGCAAGATGCGCCACGAATTGAAGC
>probe:Drosophila_2:1639683_at:243:381; Interrogation_Position=1857; Antisense; GAACCTTTGTGGTCGTCTTGTCGAA

Paste this into a BLAST search page for me
TACAAAAGTACCTTGGCCGACACGTGGCCGACACGTGTTAAGCCAGTGAAAAGTAATTCTACATCTTCCACCGAGAAATTCTGTACAACTGGCTCGTGTAGGCTCGTGTAAGAGACCATCCTGTTCCATCCTGTTTTGCGAGACCATATACATCTGTTTCGGTTTGAAGTCTGTCGTAAAAGCTGCGTCCTGTCAAACAGGTCGACCAAAGAGCGATCCCGATGTGATCCCGATGTACCATTCATGATTGTAAAGAACCGGATCCGAAGCCCACACTACAACCAAATCCTCTTCTAAATCGGCAAGATGCGCCACGAATTGAAGCGAACCTTTGTGGTCGTCTTGTCGAA

Full Affymetrix probeset data:

Annotations for 1639683_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime