FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639688_at:

>probe:Drosophila_2:1639688_at:648:691; Interrogation_Position=106; Antisense; TTTTCCCTGTTTGACGACCAAGACA
>probe:Drosophila_2:1639688_at:179:65; Interrogation_Position=13; Antisense; ATGGATTTCGAATTCCTTACTCCGC
>probe:Drosophila_2:1639688_at:381:193; Interrogation_Position=161; Antisense; AACTAATGCTGTCTGTGGCCCACTA
>probe:Drosophila_2:1639688_at:698:521; Interrogation_Position=175; Antisense; GTGGCCCACTATCCCAGTGATATGG
>probe:Drosophila_2:1639688_at:246:349; Interrogation_Position=204; Antisense; GCAGGAAATTCAGGCCGAGATCGAT
>probe:Drosophila_2:1639688_at:40:41; Interrogation_Position=223; Antisense; ATCGATGCTGATGGATCCGGTGAGT
>probe:Drosophila_2:1639688_at:515:687; Interrogation_Position=248; Antisense; TATATCTCAGCGATTTCCTTCACAT
>probe:Drosophila_2:1639688_at:495:19; Interrogation_Position=260; Antisense; ATTTCCTTCACATCATGTCTCAGAG
>probe:Drosophila_2:1639688_at:675:487; Interrogation_Position=285; Antisense; GTACGCAAACATGTCTACCGAGGAT
>probe:Drosophila_2:1639688_at:405:119; Interrogation_Position=318; Antisense; AGCTGCATTCAGAGTCTTTGACAAA
>probe:Drosophila_2:1639688_at:133:371; Interrogation_Position=343; Antisense; GAAGGAACCGGCTTAATATCTGAAT
>probe:Drosophila_2:1639688_at:492:41; Interrogation_Position=366; Antisense; ATCGGAATTTCGTCACATAATGCAG
>probe:Drosophila_2:1639688_at:531:325; Interrogation_Position=477; Antisense; GCGATTTGTCAGAATGATGTCCACT
>probe:Drosophila_2:1639688_at:693:541; Interrogation_Position=90; Antisense; GGATTTGGAGATTGCCTTTTCCCTG

Paste this into a BLAST search page for me
TTTTCCCTGTTTGACGACCAAGACAATGGATTTCGAATTCCTTACTCCGCAACTAATGCTGTCTGTGGCCCACTAGTGGCCCACTATCCCAGTGATATGGGCAGGAAATTCAGGCCGAGATCGATATCGATGCTGATGGATCCGGTGAGTTATATCTCAGCGATTTCCTTCACATATTTCCTTCACATCATGTCTCAGAGGTACGCAAACATGTCTACCGAGGATAGCTGCATTCAGAGTCTTTGACAAAGAAGGAACCGGCTTAATATCTGAATATCGGAATTTCGTCACATAATGCAGGCGATTTGTCAGAATGATGTCCACTGGATTTGGAGATTGCCTTTTCCCTG

Full Affymetrix probeset data:

Annotations for 1639688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720