FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639693_at:

>probe:Drosophila_2:1639693_at:258:79; Interrogation_Position=103; Antisense; AGGGAGATTATTGCCCGCAACGGCT
>probe:Drosophila_2:1639693_at:129:261; Interrogation_Position=133; Antisense; CAGAAAACAAAAGCACAATCGGTGG
>probe:Drosophila_2:1639693_at:202:83; Interrogation_Position=158; Antisense; AGGGCGAAATGCTGACGCTGTCGAA
>probe:Drosophila_2:1639693_at:373:285; Interrogation_Position=169; Antisense; CTGACGCTGTCGAAGATCACGCGAT
>probe:Drosophila_2:1639693_at:147:35; Interrogation_Position=184; Antisense; ATCACGCGATCGGAAATGGGCGCCT
>probe:Drosophila_2:1639693_at:298:169; Interrogation_Position=197; Antisense; AAATGGGCGCCTACATGTGCATTGC
>probe:Drosophila_2:1639693_at:513:625; Interrogation_Position=233; Antisense; TGCCACCGACGGTGAGCAAGCGGAT
>probe:Drosophila_2:1639693_at:643:329; Interrogation_Position=252; Antisense; GCGGATGAAGCTACAGGTGCACTGT
>probe:Drosophila_2:1639693_at:523:153; Interrogation_Position=264; Antisense; ACAGGTGCACTGTGAGTACCACTAC
>probe:Drosophila_2:1639693_at:179:355; Interrogation_Position=270; Antisense; GCACTGTGAGTACCACTACAGTATA
>probe:Drosophila_2:1639693_at:106:545; Interrogation_Position=31; Antisense; GGATCCGCCAAGCTCGTTTGCCGAG
>probe:Drosophila_2:1639693_at:543:693; Interrogation_Position=47; Antisense; TTTGCCGAGCACGTGGTCATCCGAA
>probe:Drosophila_2:1639693_at:105:519; Interrogation_Position=59; Antisense; GTGGTCATCCGAAGCCGAAGATCAC
>probe:Drosophila_2:1639693_at:436:297; Interrogation_Position=74; Antisense; CGAAGATCACGTGGCGACGCGAAGA

Paste this into a BLAST search page for me
AGGGAGATTATTGCCCGCAACGGCTCAGAAAACAAAAGCACAATCGGTGGAGGGCGAAATGCTGACGCTGTCGAACTGACGCTGTCGAAGATCACGCGATATCACGCGATCGGAAATGGGCGCCTAAATGGGCGCCTACATGTGCATTGCTGCCACCGACGGTGAGCAAGCGGATGCGGATGAAGCTACAGGTGCACTGTACAGGTGCACTGTGAGTACCACTACGCACTGTGAGTACCACTACAGTATAGGATCCGCCAAGCTCGTTTGCCGAGTTTGCCGAGCACGTGGTCATCCGAAGTGGTCATCCGAAGCCGAAGATCACCGAAGATCACGTGGCGACGCGAAGA

Full Affymetrix probeset data:

Annotations for 1639693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720