Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639694_s_at:

>probe:Drosophila_2:1639694_s_at:22:521; Interrogation_Position=117; Antisense; GTGGAAGGAAGCCATCGCTCTCATC
>probe:Drosophila_2:1639694_s_at:451:123; Interrogation_Position=164; Antisense; AGCCCGCCTACCAGATCTACATGGA
>probe:Drosophila_2:1639694_s_at:704:207; Interrogation_Position=202; Antisense; AAGCAGGACGACCATGACCCCATTG
>probe:Drosophila_2:1639694_s_at:392:55; Interrogation_Position=215; Antisense; ATGACCCCATTGACACCTTCGTCAT
>probe:Drosophila_2:1639694_s_at:178:717; Interrogation_Position=232; Antisense; TTCGTCATCCAGAAGCGAGCGCTGC
>probe:Drosophila_2:1639694_s_at:6:197; Interrogation_Position=296; Antisense; AACTGGATCTTCTGTTCGGTCTGCT
>probe:Drosophila_2:1639694_s_at:508:469; Interrogation_Position=309; Antisense; GTTCGGTCTGCTGAACATCAAGTAC
>probe:Drosophila_2:1639694_s_at:562:383; Interrogation_Position=321; Antisense; GAACATCAAGTACCGCAAGCACATC
>probe:Drosophila_2:1639694_s_at:58:259; Interrogation_Position=352; Antisense; CACAGTGTCCATACCTTCAAGGATC
>probe:Drosophila_2:1639694_s_at:690:223; Interrogation_Position=370; Antisense; AAGGATCTCCTGGAACAGGGCCGCA
>probe:Drosophila_2:1639694_s_at:220:83; Interrogation_Position=386; Antisense; AGGGCCGCATCATCGAGCACAACAA
>probe:Drosophila_2:1639694_s_at:628:409; Interrogation_Position=418; Antisense; GACGAGGAACAGCTTGCCACAGCAA
>probe:Drosophila_2:1639694_s_at:166:171; Interrogation_Position=441; Antisense; AAAGAACACCCGTGGCTCCAAGCGC
>probe:Drosophila_2:1639694_s_at:659:397; Interrogation_Position=508; Antisense; GACAACTGCCGTAAGCGCCAGAAGG

Paste this into a BLAST search page for me
GTGGAAGGAAGCCATCGCTCTCATCAGCCCGCCTACCAGATCTACATGGAAAGCAGGACGACCATGACCCCATTGATGACCCCATTGACACCTTCGTCATTTCGTCATCCAGAAGCGAGCGCTGCAACTGGATCTTCTGTTCGGTCTGCTGTTCGGTCTGCTGAACATCAAGTACGAACATCAAGTACCGCAAGCACATCCACAGTGTCCATACCTTCAAGGATCAAGGATCTCCTGGAACAGGGCCGCAAGGGCCGCATCATCGAGCACAACAAGACGAGGAACAGCTTGCCACAGCAAAAAGAACACCCGTGGCTCCAAGCGCGACAACTGCCGTAAGCGCCAGAAGG

Full Affymetrix probeset data:

Annotations for 1639694_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime