Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639696_at:

>probe:Drosophila_2:1639696_at:628:269; Interrogation_Position=1854; Antisense; CATGTACAGCAGTCGCGAGGATTTC
>probe:Drosophila_2:1639696_at:7:459; Interrogation_Position=1873; Antisense; GATTTCGCCGCCTCGGAAAGGGCAT
>probe:Drosophila_2:1639696_at:453:41; Interrogation_Position=1896; Antisense; ATCGGTGGACATCAGTGAGGCCTTT
>probe:Drosophila_2:1639696_at:601:525; Interrogation_Position=1984; Antisense; GGTGGAAGCTTTATGGCCGGAAACA
>probe:Drosophila_2:1639696_at:701:153; Interrogation_Position=2006; Antisense; ACAGGAACCTTTACTCCAGCGAGAT
>probe:Drosophila_2:1639696_at:604:97; Interrogation_Position=2033; Antisense; AGATGCCGGATCCTGGCTACGGACA
>probe:Drosophila_2:1639696_at:94:527; Interrogation_Position=2060; Antisense; GGGACTCGGCCAGCAGGGATATTTC
>probe:Drosophila_2:1639696_at:673:17; Interrogation_Position=2080; Antisense; ATTTCGTTGGGAGGCAGTCGACCAC
>probe:Drosophila_2:1639696_at:605:535; Interrogation_Position=2112; Antisense; GGTGCCCATTCAGATATCCGGAAGT
>probe:Drosophila_2:1639696_at:660:561; Interrogation_Position=2131; Antisense; GGAAGTGGCAGTCACGTCTACCGAC
>probe:Drosophila_2:1639696_at:89:525; Interrogation_Position=2260; Antisense; GGGCGATCCCAGGAGCAGCTCTATG
>probe:Drosophila_2:1639696_at:105:475; Interrogation_Position=2308; Antisense; GTTAGTTTCCATTTTGACGAACGCA
>probe:Drosophila_2:1639696_at:77:99; Interrogation_Position=2392; Antisense; AGAGACTTTCTCGAACGGACCTATT
>probe:Drosophila_2:1639696_at:342:1; Interrogation_Position=2402; Antisense; TCGAACGGACCTATTTCACTCGGTA

Paste this into a BLAST search page for me
CATGTACAGCAGTCGCGAGGATTTCGATTTCGCCGCCTCGGAAAGGGCATATCGGTGGACATCAGTGAGGCCTTTGGTGGAAGCTTTATGGCCGGAAACAACAGGAACCTTTACTCCAGCGAGATAGATGCCGGATCCTGGCTACGGACAGGGACTCGGCCAGCAGGGATATTTCATTTCGTTGGGAGGCAGTCGACCACGGTGCCCATTCAGATATCCGGAAGTGGAAGTGGCAGTCACGTCTACCGACGGGCGATCCCAGGAGCAGCTCTATGGTTAGTTTCCATTTTGACGAACGCAAGAGACTTTCTCGAACGGACCTATTTCGAACGGACCTATTTCACTCGGTA

Full Affymetrix probeset data:

Annotations for 1639696_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime