Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639698_at:

>probe:Drosophila_2:1639698_at:3:513; Interrogation_Position=1006; Antisense; GTGTTCGGGCGCAATTTGGATTTCA
>probe:Drosophila_2:1639698_at:146:115; Interrogation_Position=504; Antisense; AGCAGGTACCGGTCAGGATCAGCCA
>probe:Drosophila_2:1639698_at:396:3; Interrogation_Position=616; Antisense; ATTGAAAAGACGAGCCCACACTACT
>probe:Drosophila_2:1639698_at:619:667; Interrogation_Position=637; Antisense; TACTCACAGCAATCCAATTCGCATT
>probe:Drosophila_2:1639698_at:365:391; Interrogation_Position=664; Antisense; GAAACCCATCCAAATCAACTAGCGC
>probe:Drosophila_2:1639698_at:388:455; Interrogation_Position=718; Antisense; GATAATGTGCAGATGGCTCCCAAAG
>probe:Drosophila_2:1639698_at:585:397; Interrogation_Position=745; Antisense; GACAAGCCGCTGACTTTAGAACATA
>probe:Drosophila_2:1639698_at:188:685; Interrogation_Position=768; Antisense; TATCGAGTTGCATGCGTATACAGCG
>probe:Drosophila_2:1639698_at:379:323; Interrogation_Position=790; Antisense; GCGCAAAGTGCTCCCCGAAATTTAT
>probe:Drosophila_2:1639698_at:469:165; Interrogation_Position=820; Antisense; AAATCCGTAGTTGATCTGCCCATAC
>probe:Drosophila_2:1639698_at:74:87; Interrogation_Position=872; Antisense; AGACCGCAACGGAGGCATCTAACGT
>probe:Drosophila_2:1639698_at:5:521; Interrogation_Position=895; Antisense; GTGGAATCGAAGTTGCGCGCGCCCA
>probe:Drosophila_2:1639698_at:438:195; Interrogation_Position=943; Antisense; AACGGTCGACTGGATCATTACTCAA
>probe:Drosophila_2:1639698_at:407:251; Interrogation_Position=975; Antisense; CAAGGAGGCCTATTTGAACCAGTTG

Paste this into a BLAST search page for me
GTGTTCGGGCGCAATTTGGATTTCAAGCAGGTACCGGTCAGGATCAGCCAATTGAAAAGACGAGCCCACACTACTTACTCACAGCAATCCAATTCGCATTGAAACCCATCCAAATCAACTAGCGCGATAATGTGCAGATGGCTCCCAAAGGACAAGCCGCTGACTTTAGAACATATATCGAGTTGCATGCGTATACAGCGGCGCAAAGTGCTCCCCGAAATTTATAAATCCGTAGTTGATCTGCCCATACAGACCGCAACGGAGGCATCTAACGTGTGGAATCGAAGTTGCGCGCGCCCAAACGGTCGACTGGATCATTACTCAACAAGGAGGCCTATTTGAACCAGTTG

Full Affymetrix probeset data:

Annotations for 1639698_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime