FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639704_at:

>probe:Drosophila_2:1639704_at:351:665; Interrogation_Position=284; Antisense; TAAATCCCGACGACTTTGGCAGCTA
>probe:Drosophila_2:1639704_at:33:373; Interrogation_Position=312; Antisense; GAAGGGATTGCCACCGCGAATCTAT
>probe:Drosophila_2:1639704_at:724:433; Interrogation_Position=349; Antisense; GAGGGCCGAGTGTACGATATGCACA
>probe:Drosophila_2:1639704_at:604:333; Interrogation_Position=375; Antisense; GCTGGTCAACGCCAAATACCTGAGG
>probe:Drosophila_2:1639704_at:87:215; Interrogation_Position=389; Antisense; AATACCTGAGGGAGTTTTGCGACCA
>probe:Drosophila_2:1639704_at:185:695; Interrogation_Position=404; Antisense; TTTGCGACCAGTTGCTGGCGGATCA
>probe:Drosophila_2:1639704_at:706:605; Interrogation_Position=527; Antisense; TGATGCTATATGATCCTGCCTGCTA
>probe:Drosophila_2:1639704_at:714:435; Interrogation_Position=607; Antisense; GAGGATCTGCCCATTGTGATCGTAG
>probe:Drosophila_2:1639704_at:401:363; Interrogation_Position=639; Antisense; GAATAACTACCTGGGCGTGGGCTTC
>probe:Drosophila_2:1639704_at:491:649; Interrogation_Position=662; Antisense; TCACCCGTTGGCTGCAGATGGTCAA
>probe:Drosophila_2:1639704_at:303:99; Interrogation_Position=677; Antisense; AGATGGTCAACTGTCACGGCTCCAC
>probe:Drosophila_2:1639704_at:93:311; Interrogation_Position=715; Antisense; CCACGTCGCGATGGCTGGGATATTA
>probe:Drosophila_2:1639704_at:547:425; Interrogation_Position=757; Antisense; GAGAGCACACGTGGCTACCTGCGAT
>probe:Drosophila_2:1639704_at:186:419; Interrogation_Position=805; Antisense; GAGCTAATTGACTTCGATGCCGATG

Paste this into a BLAST search page for me
TAAATCCCGACGACTTTGGCAGCTAGAAGGGATTGCCACCGCGAATCTATGAGGGCCGAGTGTACGATATGCACAGCTGGTCAACGCCAAATACCTGAGGAATACCTGAGGGAGTTTTGCGACCATTTGCGACCAGTTGCTGGCGGATCATGATGCTATATGATCCTGCCTGCTAGAGGATCTGCCCATTGTGATCGTAGGAATAACTACCTGGGCGTGGGCTTCTCACCCGTTGGCTGCAGATGGTCAAAGATGGTCAACTGTCACGGCTCCACCCACGTCGCGATGGCTGGGATATTAGAGAGCACACGTGGCTACCTGCGATGAGCTAATTGACTTCGATGCCGATG

Full Affymetrix probeset data:

Annotations for 1639704_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720