FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639711_at:

>probe:Drosophila_2:1639711_at:445:259; Interrogation_Position=103; Antisense; CACGTATGTTCTGCTGATGTTGCCG
>probe:Drosophila_2:1639711_at:403:479; Interrogation_Position=15; Antisense; GTTTCGACGCGACTCTGAAGGATTT
>probe:Drosophila_2:1639711_at:387:59; Interrogation_Position=151; Antisense; ATGTTGCCGTCAGCATGTCAGAGCC
>probe:Drosophila_2:1639711_at:463:709; Interrogation_Position=198; Antisense; TTACACACATGTTTTCTGCGGCCAA
>probe:Drosophila_2:1639711_at:691:391; Interrogation_Position=270; Antisense; GAAACCAAACCTACGGCTGAGAGCA
>probe:Drosophila_2:1639711_at:181:425; Interrogation_Position=288; Antisense; GAGAGCAGCCAAAGCCGATGATTTA
>probe:Drosophila_2:1639711_at:716:417; Interrogation_Position=307; Antisense; GATTTAGGCCCGGAGTCGGACGACT
>probe:Drosophila_2:1639711_at:547:371; Interrogation_Position=31; Antisense; GAAGGATTTTCATGGCTGGTAGCTA
>probe:Drosophila_2:1639711_at:257:443; Interrogation_Position=352; Antisense; GATGTGCAGGATGAGCCCGCCACCA
>probe:Drosophila_2:1639711_at:356:303; Interrogation_Position=368; Antisense; CCGCCACCATCGATTGCAATGAGAA
>probe:Drosophila_2:1639711_at:210:73; Interrogation_Position=395; Antisense; AGGCATTCGAGAGCCCTGCGATCGA
>probe:Drosophila_2:1639711_at:683:371; Interrogation_Position=426; Antisense; GAAGTTCTACTTTGCGGACCATTTC
>probe:Drosophila_2:1639711_at:421:81; Interrogation_Position=469; Antisense; AGGGACAGTCAACCACCATACAAGT
>probe:Drosophila_2:1639711_at:187:31; Interrogation_Position=486; Antisense; ATACAAGTCGGAGTCGCCACGATAA

Paste this into a BLAST search page for me
CACGTATGTTCTGCTGATGTTGCCGGTTTCGACGCGACTCTGAAGGATTTATGTTGCCGTCAGCATGTCAGAGCCTTACACACATGTTTTCTGCGGCCAAGAAACCAAACCTACGGCTGAGAGCAGAGAGCAGCCAAAGCCGATGATTTAGATTTAGGCCCGGAGTCGGACGACTGAAGGATTTTCATGGCTGGTAGCTAGATGTGCAGGATGAGCCCGCCACCACCGCCACCATCGATTGCAATGAGAAAGGCATTCGAGAGCCCTGCGATCGAGAAGTTCTACTTTGCGGACCATTTCAGGGACAGTCAACCACCATACAAGTATACAAGTCGGAGTCGCCACGATAA

Full Affymetrix probeset data:

Annotations for 1639711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720