FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639712_at:

>probe:Drosophila_2:1639712_at:661:179; Interrogation_Position=140; Antisense; AAACATAAACCTACGTTGCTGCCGT
>probe:Drosophila_2:1639712_at:287:469; Interrogation_Position=154; Antisense; GTTGCTGCCGTATATTATGGACATG
>probe:Drosophila_2:1639712_at:280:557; Interrogation_Position=172; Antisense; GGACATGCTAAGTCGCGAGACGCAA
>probe:Drosophila_2:1639712_at:292:357; Interrogation_Position=193; Antisense; GCAAATGTGCTCTTCTGTGGACGAC
>probe:Drosophila_2:1639712_at:620:33; Interrogation_Position=230; Antisense; ATCAAGGACGTTATGCTCGAGGAGC
>probe:Drosophila_2:1639712_at:374:637; Interrogation_Position=246; Antisense; TCGAGGAGCACGTCAGAGCCTTCGG
>probe:Drosophila_2:1639712_at:427:85; Interrogation_Position=260; Antisense; AGAGCCTTCGGGAGCCTCAAGCGTG
>probe:Drosophila_2:1639712_at:708:651; Interrogation_Position=276; Antisense; TCAAGCGTGCGGTGGAGTTTGCCCT
>probe:Drosophila_2:1639712_at:31:467; Interrogation_Position=304; Antisense; GTTGGGCGTCAACATGGGCATCCTC
>probe:Drosophila_2:1639712_at:599:569; Interrogation_Position=320; Antisense; GGCATCCTCTCGATGACCAAGACGG
>probe:Drosophila_2:1639712_at:546:49; Interrogation_Position=350; Antisense; ATGCCCATCAGGTACCGCAGAAGTA
>probe:Drosophila_2:1639712_at:46:491; Interrogation_Position=372; Antisense; GTAAATCCAAGACTAAGGTGCCTGT
>probe:Drosophila_2:1639712_at:49:253; Interrogation_Position=478; Antisense; CAAGAAGCGGTCAGGCGGACGCCTA
>probe:Drosophila_2:1639712_at:600:589; Interrogation_Position=76; Antisense; TGGATCGGCACACAAACATTCATTT

Paste this into a BLAST search page for me
AAACATAAACCTACGTTGCTGCCGTGTTGCTGCCGTATATTATGGACATGGGACATGCTAAGTCGCGAGACGCAAGCAAATGTGCTCTTCTGTGGACGACATCAAGGACGTTATGCTCGAGGAGCTCGAGGAGCACGTCAGAGCCTTCGGAGAGCCTTCGGGAGCCTCAAGCGTGTCAAGCGTGCGGTGGAGTTTGCCCTGTTGGGCGTCAACATGGGCATCCTCGGCATCCTCTCGATGACCAAGACGGATGCCCATCAGGTACCGCAGAAGTAGTAAATCCAAGACTAAGGTGCCTGTCAAGAAGCGGTCAGGCGGACGCCTATGGATCGGCACACAAACATTCATTT

Full Affymetrix probeset data:

Annotations for 1639712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720