FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639713_at:

>probe:Drosophila_2:1639713_at:287:551; Interrogation_Position=103; Antisense; GGAGAAGTCTACCTGCCGGCTGAAA
>probe:Drosophila_2:1639713_at:338:141; Interrogation_Position=157; Antisense; ACGGAATACTTTACCTATGCGGCTC
>probe:Drosophila_2:1639713_at:581:605; Interrogation_Position=192; Antisense; TGATCAGGTGGCTCCATGGCAATCA
>probe:Drosophila_2:1639713_at:225:267; Interrogation_Position=219; Antisense; CAGGGAATTGGCCAAGGTGCTCTCC
>probe:Drosophila_2:1639713_at:706:409; Interrogation_Position=279; Antisense; GACGAATATCTTTACACTGACTGCT
>probe:Drosophila_2:1639713_at:708:655; Interrogation_Position=321; Antisense; TAATCCACTGGACATCTTTGTGCTC
>probe:Drosophila_2:1639713_at:158:447; Interrogation_Position=358; Antisense; GATGCAGATGCTCTGGCCAAACAGC
>probe:Drosophila_2:1639713_at:705:387; Interrogation_Position=409; Antisense; GAAAAGCCGTCAGTACATTTCGTAA
>probe:Drosophila_2:1639713_at:14:493; Interrogation_Position=430; Antisense; GTAAAATATCGAACGCCGGCGGATG
>probe:Drosophila_2:1639713_at:236:305; Interrogation_Position=445; Antisense; CCGGCGGATGTTACTAGAGCACTAA
>probe:Drosophila_2:1639713_at:372:177; Interrogation_Position=557; Antisense; AAACGACTGAGACCCCAGTGATCTT
>probe:Drosophila_2:1639713_at:128:669; Interrogation_Position=607; Antisense; TACTACGAGACGCATGAGCCGGCAA
>probe:Drosophila_2:1639713_at:173:93; Interrogation_Position=650; Antisense; AGTTGCAGGCGCTATTTCGGGAATA
>probe:Drosophila_2:1639713_at:93:527; Interrogation_Position=668; Antisense; GGGAATATCTGCCACCGGGTAAACG

Paste this into a BLAST search page for me
GGAGAAGTCTACCTGCCGGCTGAAAACGGAATACTTTACCTATGCGGCTCTGATCAGGTGGCTCCATGGCAATCACAGGGAATTGGCCAAGGTGCTCTCCGACGAATATCTTTACACTGACTGCTTAATCCACTGGACATCTTTGTGCTCGATGCAGATGCTCTGGCCAAACAGCGAAAAGCCGTCAGTACATTTCGTAAGTAAAATATCGAACGCCGGCGGATGCCGGCGGATGTTACTAGAGCACTAAAAACGACTGAGACCCCAGTGATCTTTACTACGAGACGCATGAGCCGGCAAAGTTGCAGGCGCTATTTCGGGAATAGGGAATATCTGCCACCGGGTAAACG

Full Affymetrix probeset data:

Annotations for 1639713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720