FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639714_at:

>probe:Drosophila_2:1639714_at:714:613; Interrogation_Position=179; Antisense; TGAAGAGTTTGCTGGGACCACTGCG
>probe:Drosophila_2:1639714_at:291:111; Interrogation_Position=248; Antisense; AGCAAAACAATCTCGCGGACAACTT
>probe:Drosophila_2:1639714_at:165:59; Interrogation_Position=296; Antisense; ATGTTCCGCGGTTCGACAAGCACTT
>probe:Drosophila_2:1639714_at:580:57; Interrogation_Position=31; Antisense; ATGATGCCCATGTCTGGGCCACAAA
>probe:Drosophila_2:1639714_at:549:727; Interrogation_Position=319; Antisense; TTGGAAGACTTTTACGCCTGTTGCG
>probe:Drosophila_2:1639714_at:624:469; Interrogation_Position=338; Antisense; GTTGCGACCAGATCGAGATCCACTT
>probe:Drosophila_2:1639714_at:299:615; Interrogation_Position=362; Antisense; TGAAGACGGCGATGCAGTGCCTCCA
>probe:Drosophila_2:1639714_at:587:587; Interrogation_Position=440; Antisense; TGGAGACCTTTATGCCGGACAACGC
>probe:Drosophila_2:1639714_at:551:475; Interrogation_Position=477; Antisense; GTATCCCACTTACTTGAACACGGTC
>probe:Drosophila_2:1639714_at:385:187; Interrogation_Position=493; Antisense; AACACGGTCCGCGTTCACATACAGT
>probe:Drosophila_2:1639714_at:98:631; Interrogation_Position=517; Antisense; TCCGCCAAGGATATACACGACACTC
>probe:Drosophila_2:1639714_at:453:399; Interrogation_Position=535; Antisense; GACACTCTGATTAGTGCCGCGCAGA
>probe:Drosophila_2:1639714_at:84:323; Interrogation_Position=553; Antisense; GCGCAGAACATTTCGCAGGCTGATT
>probe:Drosophila_2:1639714_at:705:617; Interrogation_Position=59; Antisense; TGCAGGTAATGCAATCCTCGCCATC

Paste this into a BLAST search page for me
TGAAGAGTTTGCTGGGACCACTGCGAGCAAAACAATCTCGCGGACAACTTATGTTCCGCGGTTCGACAAGCACTTATGATGCCCATGTCTGGGCCACAAATTGGAAGACTTTTACGCCTGTTGCGGTTGCGACCAGATCGAGATCCACTTTGAAGACGGCGATGCAGTGCCTCCATGGAGACCTTTATGCCGGACAACGCGTATCCCACTTACTTGAACACGGTCAACACGGTCCGCGTTCACATACAGTTCCGCCAAGGATATACACGACACTCGACACTCTGATTAGTGCCGCGCAGAGCGCAGAACATTTCGCAGGCTGATTTGCAGGTAATGCAATCCTCGCCATC

Full Affymetrix probeset data:

Annotations for 1639714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720