Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639715_at:

>probe:Drosophila_2:1639715_at:214:23; Interrogation_Position=148; Antisense; ATATACCTGCGGGAATGGCTGCTGC
>probe:Drosophila_2:1639715_at:207:633; Interrogation_Position=176; Antisense; TCCGCCATTGGGACCGATGTTGGGA
>probe:Drosophila_2:1639715_at:610:299; Interrogation_Position=218; Antisense; CGCCGCTTTCTGCAAGGACTTTAAT
>probe:Drosophila_2:1639715_at:459:401; Interrogation_Position=234; Antisense; GACTTTAATGCCAAGACCGCGGAAA
>probe:Drosophila_2:1639715_at:156:337; Interrogation_Position=275; Antisense; GCTGCCGTGCAGAATTTCCGTAAAC
>probe:Drosophila_2:1639715_at:549:701; Interrogation_Position=346; Antisense; TTTTCCTGAAGCAAGCGGCGGGCAT
>probe:Drosophila_2:1639715_at:329:289; Interrogation_Position=407; Antisense; CGGCATGATCACTCTCAAGCATTTG
>probe:Drosophila_2:1639715_at:374:117; Interrogation_Position=443; Antisense; AGCTATTAAGATTCAGGACCCGCCC
>probe:Drosophila_2:1639715_at:331:231; Interrogation_Position=468; Antisense; AATGTACTTCTTACCATGCAGCAAA
>probe:Drosophila_2:1639715_at:443:427; Interrogation_Position=498; Antisense; GAGATGCTCATCAGCATTGCTCGGA
>probe:Drosophila_2:1639715_at:573:5; Interrogation_Position=513; Antisense; ATTGCTCGGACCTGTGGCATCAAAG
>probe:Drosophila_2:1639715_at:199:261; Interrogation_Position=542; Antisense; CAGGGAAATAGATCCGGCGGCCTAT
>probe:Drosophila_2:1639715_at:429:729; Interrogation_Position=595; Antisense; TTGTGGAACAGCAACGGCGCGAGTT
>probe:Drosophila_2:1639715_at:109:723; Interrogation_Position=645; Antisense; TTGCGCACGGGCTAGATTTGCTTAT

Paste this into a BLAST search page for me
ATATACCTGCGGGAATGGCTGCTGCTCCGCCATTGGGACCGATGTTGGGACGCCGCTTTCTGCAAGGACTTTAATGACTTTAATGCCAAGACCGCGGAAAGCTGCCGTGCAGAATTTCCGTAAACTTTTCCTGAAGCAAGCGGCGGGCATCGGCATGATCACTCTCAAGCATTTGAGCTATTAAGATTCAGGACCCGCCCAATGTACTTCTTACCATGCAGCAAAGAGATGCTCATCAGCATTGCTCGGAATTGCTCGGACCTGTGGCATCAAAGCAGGGAAATAGATCCGGCGGCCTATTTGTGGAACAGCAACGGCGCGAGTTTTGCGCACGGGCTAGATTTGCTTAT

Full Affymetrix probeset data:

Annotations for 1639715_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime