Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639716_at:

>probe:Drosophila_2:1639716_at:146:367; Interrogation_Position=3551; Antisense; GAATCGTGACTTCCATCGAATCGAA
>probe:Drosophila_2:1639716_at:440:247; Interrogation_Position=3590; Antisense; AATTCGCGCGCAAGGGTCAAGAGAT
>probe:Drosophila_2:1639716_at:646:387; Interrogation_Position=3621; Antisense; GAAAATCGATCCGATTCCCGGTGAA
>probe:Drosophila_2:1639716_at:109:685; Interrogation_Position=3635; Antisense; TTCCCGGTGAATCGCCCAAAATGTT
>probe:Drosophila_2:1639716_at:114:185; Interrogation_Position=3652; Antisense; AAAATGTTTGGTCGCCACTTCGAGG
>probe:Drosophila_2:1639716_at:207:605; Interrogation_Position=3689; Antisense; TGATTAGCAAGATCTCTCGCCAGAG
>probe:Drosophila_2:1639716_at:399:359; Interrogation_Position=3725; Antisense; GCAAGGATTACTTCCGTGACGATCT
>probe:Drosophila_2:1639716_at:187:205; Interrogation_Position=3806; Antisense; AAGCGATTTCGCCTGCCAAAATTGC
>probe:Drosophila_2:1639716_at:80:407; Interrogation_Position=3889; Antisense; GACTGTGTGCGCTTGTGGTGAATCC
>probe:Drosophila_2:1639716_at:673:589; Interrogation_Position=3904; Antisense; TGGTGAATCCTCTATAGTCCCGAAC
>probe:Drosophila_2:1639716_at:258:435; Interrogation_Position=3930; Antisense; GAGGATCCTTTCTCTTAAGCTTAGT
>probe:Drosophila_2:1639716_at:410:697; Interrogation_Position=3961; Antisense; TTTATGGTTTACAGCCGTAGCCGTC
>probe:Drosophila_2:1639716_at:174:723; Interrogation_Position=4052; Antisense; TTGCGAACATCCATTTTGCCTGCGA
>probe:Drosophila_2:1639716_at:650:721; Interrogation_Position=4067; Antisense; TTGCCTGCGATTTTTGTTAGAGCCA

Paste this into a BLAST search page for me
GAATCGTGACTTCCATCGAATCGAAAATTCGCGCGCAAGGGTCAAGAGATGAAAATCGATCCGATTCCCGGTGAATTCCCGGTGAATCGCCCAAAATGTTAAAATGTTTGGTCGCCACTTCGAGGTGATTAGCAAGATCTCTCGCCAGAGGCAAGGATTACTTCCGTGACGATCTAAGCGATTTCGCCTGCCAAAATTGCGACTGTGTGCGCTTGTGGTGAATCCTGGTGAATCCTCTATAGTCCCGAACGAGGATCCTTTCTCTTAAGCTTAGTTTTATGGTTTACAGCCGTAGCCGTCTTGCGAACATCCATTTTGCCTGCGATTGCCTGCGATTTTTGTTAGAGCCA

Full Affymetrix probeset data:

Annotations for 1639716_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime