FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639718_at:

>probe:Drosophila_2:1639718_at:326:423; Interrogation_Position=1008; Antisense; GAGAAGCCATACGACTGCCGCTTTT
>probe:Drosophila_2:1639718_at:254:725; Interrogation_Position=1031; Antisense; TTGCACCAAGTCCTTTCACAATAGC
>probe:Drosophila_2:1639718_at:585:393; Interrogation_Position=1074; Antisense; GAAAGGACTCACACCAATGCCAAAC
>probe:Drosophila_2:1639718_at:56:177; Interrogation_Position=1095; Antisense; AAACCCTACAGCTGTCATCATTGCG
>probe:Drosophila_2:1639718_at:594:475; Interrogation_Position=1126; Antisense; GTTTTAAGTCAGCTTCGGGACGCAA
>probe:Drosophila_2:1639718_at:367:331; Interrogation_Position=1151; Antisense; GCGGCACGAACTAATCCATACAGGA
>probe:Drosophila_2:1639718_at:702:719; Interrogation_Position=1212; Antisense; TTCCAGCGCAACACTCACTTAAAGG
>probe:Drosophila_2:1639718_at:456:69; Interrogation_Position=1234; Antisense; AGGCCCATCTGCGATCTAAATTTCA
>probe:Drosophila_2:1639718_at:555:675; Interrogation_Position=814; Antisense; TAGAGCGTAAGCGACTGCAGCGTAA
>probe:Drosophila_2:1639718_at:586:563; Interrogation_Position=868; Antisense; GGCAATTCACCGACCAAAGCAATTT
>probe:Drosophila_2:1639718_at:641:17; Interrogation_Position=889; Antisense; ATTTCAAGCTTCACATGCTGCGGCA
>probe:Drosophila_2:1639718_at:68:265; Interrogation_Position=939; Antisense; CAGCAGTGTGGCAAGCGGTTCTACA
>probe:Drosophila_2:1639718_at:517:37; Interrogation_Position=970; Antisense; ATCTCATGACGCTGCACCAACGAAT
>probe:Drosophila_2:1639718_at:429:199; Interrogation_Position=988; Antisense; AACGAATCATTCACCAGGGCGAGAA

Paste this into a BLAST search page for me
GAGAAGCCATACGACTGCCGCTTTTTTGCACCAAGTCCTTTCACAATAGCGAAAGGACTCACACCAATGCCAAACAAACCCTACAGCTGTCATCATTGCGGTTTTAAGTCAGCTTCGGGACGCAAGCGGCACGAACTAATCCATACAGGATTCCAGCGCAACACTCACTTAAAGGAGGCCCATCTGCGATCTAAATTTCATAGAGCGTAAGCGACTGCAGCGTAAGGCAATTCACCGACCAAAGCAATTTATTTCAAGCTTCACATGCTGCGGCACAGCAGTGTGGCAAGCGGTTCTACAATCTCATGACGCTGCACCAACGAATAACGAATCATTCACCAGGGCGAGAA

Full Affymetrix probeset data:

Annotations for 1639718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720