FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639719_at:

>probe:Drosophila_2:1639719_at:428:527; Interrogation_Position=1320; Antisense; GGAAAACGAATATCTTGACTTGGCT
>probe:Drosophila_2:1639719_at:90:137; Interrogation_Position=1325; Antisense; ACGAATATCTTGACTTGGCTATAAT
>probe:Drosophila_2:1639719_at:398:609; Interrogation_Position=1335; Antisense; TGACTTGGCTATAATGTTTTTTGAA
>probe:Drosophila_2:1639719_at:220:601; Interrogation_Position=1349; Antisense; TGTTTTTTGAAGCACCCAACACCAA
>probe:Drosophila_2:1639719_at:327:703; Interrogation_Position=1353; Antisense; TTTTGAAGCACCCAACACCAAACAC
>probe:Drosophila_2:1639719_at:212:173; Interrogation_Position=1586; Antisense; AAAGAACACAAGACTCTTGGGAAAG
>probe:Drosophila_2:1639719_at:353:183; Interrogation_Position=1633; Antisense; AAAAGTGCGTGTGTAATTTATATAT
>probe:Drosophila_2:1639719_at:29:341; Interrogation_Position=1754; Antisense; GCTATCAATGCCTTTCCTTTGGGCG
>probe:Drosophila_2:1639719_at:348:49; Interrogation_Position=1761; Antisense; ATGCCTTTCCTTTGGGCGGGACAAG
>probe:Drosophila_2:1639719_at:204:703; Interrogation_Position=1789; Antisense; TTTTGGGATTGAGGATGCGAGTAAC
>probe:Drosophila_2:1639719_at:13:327; Interrogation_Position=1805; Antisense; GCGAGTAACAGCTTGATTCCTGCCA
>probe:Drosophila_2:1639719_at:65:91; Interrogation_Position=1808; Antisense; AGTAACAGCTTGATTCCTGCCACCA
>probe:Drosophila_2:1639719_at:435:643; Interrogation_Position=1847; Antisense; TCTCTTCCAGCCCTCAGAAATATTG
>probe:Drosophila_2:1639719_at:406:629; Interrogation_Position=1852; Antisense; TCCAGCCCTCAGAAATATTGTGAAT

Paste this into a BLAST search page for me
GGAAAACGAATATCTTGACTTGGCTACGAATATCTTGACTTGGCTATAATTGACTTGGCTATAATGTTTTTTGAATGTTTTTTGAAGCACCCAACACCAATTTTGAAGCACCCAACACCAAACACAAAGAACACAAGACTCTTGGGAAAGAAAAGTGCGTGTGTAATTTATATATGCTATCAATGCCTTTCCTTTGGGCGATGCCTTTCCTTTGGGCGGGACAAGTTTTGGGATTGAGGATGCGAGTAACGCGAGTAACAGCTTGATTCCTGCCAAGTAACAGCTTGATTCCTGCCACCATCTCTTCCAGCCCTCAGAAATATTGTCCAGCCCTCAGAAATATTGTGAAT

Full Affymetrix probeset data:

Annotations for 1639719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720