FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639721_at:

>probe:Drosophila_2:1639721_at:639:241; Interrogation_Position=2404; Antisense; AATACTCCTGTGGTCTGTTAGCTGT
>probe:Drosophila_2:1639721_at:43:89; Interrogation_Position=2430; Antisense; AGTCTCCGCGCTTAGTTATATTTTG
>probe:Drosophila_2:1639721_at:687:21; Interrogation_Position=2447; Antisense; ATATTTTGCAGACCGTGCTGCTCTT
>probe:Drosophila_2:1639721_at:491:507; Interrogation_Position=2461; Antisense; GTGCTGCTCTTGTTATCTAGTCCTT
>probe:Drosophila_2:1639721_at:289:507; Interrogation_Position=2490; Antisense; GTGCCCCAATGCTTGGTGGTTCCAA
>probe:Drosophila_2:1639721_at:42:591; Interrogation_Position=2506; Antisense; TGGTTCCAAAACCTGTGCATTGCAT
>probe:Drosophila_2:1639721_at:406:701; Interrogation_Position=2536; Antisense; TTTTGCGTTATTACCTTCGTTATAT
>probe:Drosophila_2:1639721_at:426:615; Interrogation_Position=2678; Antisense; TGAATTCTATGCACACACACACCCA
>probe:Drosophila_2:1639721_at:571:635; Interrogation_Position=2759; Antisense; TCGAATGCGATTTCCGAGCAGCTGA
>probe:Drosophila_2:1639721_at:132:41; Interrogation_Position=2821; Antisense; ATCTGTACTGTCTAGCCTTATGTCC
>probe:Drosophila_2:1639721_at:698:535; Interrogation_Position=2846; Antisense; GGTCCATGTCCTTGTCCAAATCAAT
>probe:Drosophila_2:1639721_at:195:235; Interrogation_Position=2868; Antisense; AATCCATTTGATCCGCAACTCGTAG
>probe:Drosophila_2:1639721_at:536:253; Interrogation_Position=2883; Antisense; CAACTCGTAGTCTTTAGGCTCATCG
>probe:Drosophila_2:1639721_at:454:329; Interrogation_Position=2909; Antisense; GCGGCCCAAAAATTAGGCTCTATTT

Paste this into a BLAST search page for me
AATACTCCTGTGGTCTGTTAGCTGTAGTCTCCGCGCTTAGTTATATTTTGATATTTTGCAGACCGTGCTGCTCTTGTGCTGCTCTTGTTATCTAGTCCTTGTGCCCCAATGCTTGGTGGTTCCAATGGTTCCAAAACCTGTGCATTGCATTTTTGCGTTATTACCTTCGTTATATTGAATTCTATGCACACACACACCCATCGAATGCGATTTCCGAGCAGCTGAATCTGTACTGTCTAGCCTTATGTCCGGTCCATGTCCTTGTCCAAATCAATAATCCATTTGATCCGCAACTCGTAGCAACTCGTAGTCTTTAGGCTCATCGGCGGCCCAAAAATTAGGCTCTATTT

Full Affymetrix probeset data:

Annotations for 1639721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720