FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639723_at:

>probe:Drosophila_2:1639723_at:166:105; Interrogation_Position=107; Antisense; AGACGAAACGCGATACCGACTGGTG
>probe:Drosophila_2:1639723_at:676:405; Interrogation_Position=124; Antisense; GACTGGTGGACTATCCTCGAGGATA
>probe:Drosophila_2:1639723_at:565:317; Interrogation_Position=181; Antisense; GCCGGCGATGAGAACGTTTTGATTT
>probe:Drosophila_2:1639723_at:304:141; Interrogation_Position=217; Antisense; ACGGTAGTTGTTCAAGCTGCTCCAA
>probe:Drosophila_2:1639723_at:639:65; Interrogation_Position=254; Antisense; ATGGAAGCACTGTAGCTCCGCAGGC
>probe:Drosophila_2:1639723_at:725:19; Interrogation_Position=28; Antisense; ATATTATTCGCAGTGGGCCTTTGCC
>probe:Drosophila_2:1639723_at:135:119; Interrogation_Position=288; Antisense; AGCTCCAGGGAGTTCACCAGGTGCG
>probe:Drosophila_2:1639723_at:66:153; Interrogation_Position=391; Antisense; ACATCGCCACAACCTGTAGTAACTG
>probe:Drosophila_2:1639723_at:186:593; Interrogation_Position=41; Antisense; TGGGCCTTTGCCTTATGTTTAGTTT
>probe:Drosophila_2:1639723_at:141:119; Interrogation_Position=456; Antisense; AGCTGCCCCTGGTGGTTAGATTATC
>probe:Drosophila_2:1639723_at:633:677; Interrogation_Position=472; Antisense; TAGATTATCTTATCCTTACCCACAC
>probe:Drosophila_2:1639723_at:475:699; Interrogation_Position=498; Antisense; TTATAACACCTCTCTAACACTAGCT
>probe:Drosophila_2:1639723_at:479:153; Interrogation_Position=584; Antisense; ACAGACGTTCATTCCGTTTTAGCCA
>probe:Drosophila_2:1639723_at:682:547; Interrogation_Position=90; Antisense; GGAGGAAACCTCTGTCAAGACGAAA

Paste this into a BLAST search page for me
AGACGAAACGCGATACCGACTGGTGGACTGGTGGACTATCCTCGAGGATAGCCGGCGATGAGAACGTTTTGATTTACGGTAGTTGTTCAAGCTGCTCCAAATGGAAGCACTGTAGCTCCGCAGGCATATTATTCGCAGTGGGCCTTTGCCAGCTCCAGGGAGTTCACCAGGTGCGACATCGCCACAACCTGTAGTAACTGTGGGCCTTTGCCTTATGTTTAGTTTAGCTGCCCCTGGTGGTTAGATTATCTAGATTATCTTATCCTTACCCACACTTATAACACCTCTCTAACACTAGCTACAGACGTTCATTCCGTTTTAGCCAGGAGGAAACCTCTGTCAAGACGAAA

Full Affymetrix probeset data:

Annotations for 1639723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720