FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639725_at:

>probe:Drosophila_2:1639725_at:598:61; Interrogation_Position=167; Antisense; ATGTCGAGAATCGTGCACATCGCGT
>probe:Drosophila_2:1639725_at:267:289; Interrogation_Position=215; Antisense; CGGCGCCCAAATTTGACTCGAATTT
>probe:Drosophila_2:1639725_at:68:245; Interrogation_Position=235; Antisense; AATTTGAGAGACATGGAGCGCACCT
>probe:Drosophila_2:1639725_at:410:417; Interrogation_Position=250; Antisense; GAGCGCACCTTGGAATTGGATCCCA
>probe:Drosophila_2:1639725_at:314:209; Interrogation_Position=299; Antisense; AAGACTCCAGCTTGGACGGACGATT
>probe:Drosophila_2:1639725_at:405:409; Interrogation_Position=328; Antisense; GACGTTTATGTAACCTCGCAGGATC
>probe:Drosophila_2:1639725_at:552:585; Interrogation_Position=428; Antisense; TGGAACGCAAAACGCCGGATGATTT
>probe:Drosophila_2:1639725_at:255:23; Interrogation_Position=462; Antisense; ATATCTGGAGCCCAACCGCATTAGC
>probe:Drosophila_2:1639725_at:265:323; Interrogation_Position=504; Antisense; GCGCCAGGCGCTTAAGTTCATCAAT
>probe:Drosophila_2:1639725_at:659:231; Interrogation_Position=526; Antisense; AATGACCACCAGTTGGATCCTGAAT
>probe:Drosophila_2:1639725_at:461:449; Interrogation_Position=541; Antisense; GATCCTGAATCCTGGCCAGCCAAGA
>probe:Drosophila_2:1639725_at:354:243; Interrogation_Position=634; Antisense; AATATGTACATACCCGACCAGAAGT
>probe:Drosophila_2:1639725_at:594:105; Interrogation_Position=663; Antisense; AGACACGATGCTAACTCAAGCCACG
>probe:Drosophila_2:1639725_at:583:299; Interrogation_Position=692; Antisense; CCCTTCTGCGGGTTAAATCGAGCTC

Paste this into a BLAST search page for me
ATGTCGAGAATCGTGCACATCGCGTCGGCGCCCAAATTTGACTCGAATTTAATTTGAGAGACATGGAGCGCACCTGAGCGCACCTTGGAATTGGATCCCAAAGACTCCAGCTTGGACGGACGATTGACGTTTATGTAACCTCGCAGGATCTGGAACGCAAAACGCCGGATGATTTATATCTGGAGCCCAACCGCATTAGCGCGCCAGGCGCTTAAGTTCATCAATAATGACCACCAGTTGGATCCTGAATGATCCTGAATCCTGGCCAGCCAAGAAATATGTACATACCCGACCAGAAGTAGACACGATGCTAACTCAAGCCACGCCCTTCTGCGGGTTAAATCGAGCTC

Full Affymetrix probeset data:

Annotations for 1639725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720