FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639727_at:

>probe:Drosophila_2:1639727_at:331:11; Interrogation_Position=1004; Antisense; ATTCTGCAGTGCATTCTTCGCAAAG
>probe:Drosophila_2:1639727_at:345:703; Interrogation_Position=1038; Antisense; TTATTGTCAGCGATGTCCAGGCCAA
>probe:Drosophila_2:1639727_at:258:215; Interrogation_Position=1061; Antisense; AAGATCGCCTACTATCTTCGTCATC
>probe:Drosophila_2:1639727_at:200:321; Interrogation_Position=1089; Antisense; GCCCGAGTCTCTACTTTTGGATCAT
>probe:Drosophila_2:1639727_at:413:429; Interrogation_Position=1168; Antisense; GAGTATGTTAAGTCACACGTCCTTA
>probe:Drosophila_2:1639727_at:339:475; Interrogation_Position=1285; Antisense; GTTACACTCGTGTTATTGCCTAACG
>probe:Drosophila_2:1639727_at:651:617; Interrogation_Position=746; Antisense; TGCTTCATTAGCTCTGTTCAGGGAA
>probe:Drosophila_2:1639727_at:332:217; Interrogation_Position=770; Antisense; AAGTTTGCCATTCCCCAAAGGGCTG
>probe:Drosophila_2:1639727_at:134:189; Interrogation_Position=810; Antisense; AACATGCCATGCAGGCTTTTGCCGA
>probe:Drosophila_2:1639727_at:246:463; Interrogation_Position=833; Antisense; GATTCCCTGCGAGCCGAGGTGGCAA
>probe:Drosophila_2:1639727_at:411:31; Interrogation_Position=866; Antisense; ATAAACGTGTCCTGCGTGAGTCCTG
>probe:Drosophila_2:1639727_at:435:133; Interrogation_Position=902; Antisense; ACCCAGCTGTCCTTGAATGCATTGA
>probe:Drosophila_2:1639727_at:592:587; Interrogation_Position=954; Antisense; TGGATGAAACCACGGCCAAGGGCAT
>probe:Drosophila_2:1639727_at:290:251; Interrogation_Position=970; Antisense; CAAGGGCATGTCACCGGATAAACTT

Paste this into a BLAST search page for me
ATTCTGCAGTGCATTCTTCGCAAAGTTATTGTCAGCGATGTCCAGGCCAAAAGATCGCCTACTATCTTCGTCATCGCCCGAGTCTCTACTTTTGGATCATGAGTATGTTAAGTCACACGTCCTTAGTTACACTCGTGTTATTGCCTAACGTGCTTCATTAGCTCTGTTCAGGGAAAAGTTTGCCATTCCCCAAAGGGCTGAACATGCCATGCAGGCTTTTGCCGAGATTCCCTGCGAGCCGAGGTGGCAAATAAACGTGTCCTGCGTGAGTCCTGACCCAGCTGTCCTTGAATGCATTGATGGATGAAACCACGGCCAAGGGCATCAAGGGCATGTCACCGGATAAACTT

Full Affymetrix probeset data:

Annotations for 1639727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720