Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639728_at:

>probe:Drosophila_2:1639728_at:439:679; Interrogation_Position=1642; Antisense; TAGGAGCGTAGTTCAGCCGTGTCAT
>probe:Drosophila_2:1639728_at:236:125; Interrogation_Position=1656; Antisense; AGCCGTGTCATTGTGTTTATGTTCA
>probe:Drosophila_2:1639728_at:410:489; Interrogation_Position=1718; Antisense; GTACATACTTATGTGCGCGCATTTG
>probe:Drosophila_2:1639728_at:372:597; Interrogation_Position=1729; Antisense; TGTGCGCGCATTTGTATTACCATTG
>probe:Drosophila_2:1639728_at:31:673; Interrogation_Position=1746; Antisense; TACCATTGTAGCCAAGGTCAACACA
>probe:Drosophila_2:1639728_at:125:705; Interrogation_Position=1780; Antisense; TTAGCCAACGAAATCTGGTCGAGTT
>probe:Drosophila_2:1639728_at:675:477; Interrogation_Position=1846; Antisense; GTTTAAGCGCATATGTACCTACGTA
>probe:Drosophila_2:1639728_at:214:681; Interrogation_Position=1857; Antisense; TATGTACCTACGTACGTATGCCGTA
>probe:Drosophila_2:1639728_at:265:483; Interrogation_Position=1872; Antisense; GTATGCCGTAGGAGTAGTAGCCAAA
>probe:Drosophila_2:1639728_at:466:477; Interrogation_Position=1898; Antisense; GTTTCTAGTTGATATCTTCCGCATG
>probe:Drosophila_2:1639728_at:290:459; Interrogation_Position=1908; Antisense; GATATCTTCCGCATGTAGTCCAAAT
>probe:Drosophila_2:1639728_at:412:245; Interrogation_Position=1958; Antisense; AATTACATACATGCCTAACCATCGG
>probe:Drosophila_2:1639728_at:330:567; Interrogation_Position=1981; Antisense; GGCAGCGCATTTAGCCCTCCTTTTA
>probe:Drosophila_2:1639728_at:563:551; Interrogation_Position=2086; Antisense; GGAGCTATGTTAATGTCTACGTCTA

Paste this into a BLAST search page for me
TAGGAGCGTAGTTCAGCCGTGTCATAGCCGTGTCATTGTGTTTATGTTCAGTACATACTTATGTGCGCGCATTTGTGTGCGCGCATTTGTATTACCATTGTACCATTGTAGCCAAGGTCAACACATTAGCCAACGAAATCTGGTCGAGTTGTTTAAGCGCATATGTACCTACGTATATGTACCTACGTACGTATGCCGTAGTATGCCGTAGGAGTAGTAGCCAAAGTTTCTAGTTGATATCTTCCGCATGGATATCTTCCGCATGTAGTCCAAATAATTACATACATGCCTAACCATCGGGGCAGCGCATTTAGCCCTCCTTTTAGGAGCTATGTTAATGTCTACGTCTA

Full Affymetrix probeset data:

Annotations for 1639728_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime