Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639730_at:

>probe:Drosophila_2:1639730_at:602:439; Interrogation_Position=103; Antisense; GATGTTAGGCCAACGGAGCCCACGA
>probe:Drosophila_2:1639730_at:22:449; Interrogation_Position=142; Antisense; GATGCCACAAGAACCTCTACAACAA
>probe:Drosophila_2:1639730_at:546:709; Interrogation_Position=207; Antisense; TTCAACAACGAAACCCATCACGACT
>probe:Drosophila_2:1639730_at:288:173; Interrogation_Position=237; Antisense; AACACAAAGGCCTCCCTTTGAGCAA
>probe:Drosophila_2:1639730_at:268:607; Interrogation_Position=255; Antisense; TGAGCAACCCACACGGACAACCGAG
>probe:Drosophila_2:1639730_at:89:517; Interrogation_Position=289; Antisense; GTGTGGATGCAACCGATAGAAAGAT
>probe:Drosophila_2:1639730_at:588:91; Interrogation_Position=335; Antisense; AGTATAATACTTGCTGGCCAGTCCC
>probe:Drosophila_2:1639730_at:39:435; Interrogation_Position=363; Antisense; GAGGGCCACTTGTTATCGCTGCTGC
>probe:Drosophila_2:1639730_at:129:669; Interrogation_Position=391; Antisense; TACTACGACAGCCATATCACCGAAT
>probe:Drosophila_2:1639730_at:344:59; Interrogation_Position=414; Antisense; ATGTAGTAAGCTCCACCAAGGGCCT
>probe:Drosophila_2:1639730_at:436:1; Interrogation_Position=428; Antisense; ACCAAGGGCCTTGTGTGGCGTATGA
>probe:Drosophila_2:1639730_at:693:679; Interrogation_Position=454; Antisense; TATGGCCAACTGAAAGTGCACGTAA
>probe:Drosophila_2:1639730_at:303:699; Interrogation_Position=51; Antisense; TTTTCTGTTGGGAGGCATTTGGGCT
>probe:Drosophila_2:1639730_at:406:345; Interrogation_Position=65; Antisense; GCATTTGGGCTCAGGATGTTATACC

Paste this into a BLAST search page for me
GATGTTAGGCCAACGGAGCCCACGAGATGCCACAAGAACCTCTACAACAATTCAACAACGAAACCCATCACGACTAACACAAAGGCCTCCCTTTGAGCAATGAGCAACCCACACGGACAACCGAGGTGTGGATGCAACCGATAGAAAGATAGTATAATACTTGCTGGCCAGTCCCGAGGGCCACTTGTTATCGCTGCTGCTACTACGACAGCCATATCACCGAATATGTAGTAAGCTCCACCAAGGGCCTACCAAGGGCCTTGTGTGGCGTATGATATGGCCAACTGAAAGTGCACGTAATTTTCTGTTGGGAGGCATTTGGGCTGCATTTGGGCTCAGGATGTTATACC

Full Affymetrix probeset data:

Annotations for 1639730_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime