Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639731_at:

>probe:Drosophila_2:1639731_at:69:679; Interrogation_Position=1197; Antisense; TAGTTTTAGTTATTCCTTTGCCATA
>probe:Drosophila_2:1639731_at:519:277; Interrogation_Position=1212; Antisense; CTTTGCCATATTTCTTCTCTAGTCA
>probe:Drosophila_2:1639731_at:272:471; Interrogation_Position=1246; Antisense; GTTCCCAAGCTGAATTCTATCTCAC
>probe:Drosophila_2:1639731_at:142:469; Interrogation_Position=1330; Antisense; GTTGATTTTCACCACATATTTACTT
>probe:Drosophila_2:1639731_at:117:53; Interrogation_Position=1366; Antisense; ATGCACTGTTCTGTTCTCATTTAGA
>probe:Drosophila_2:1639731_at:503:725; Interrogation_Position=1408; Antisense; TTGTAAACTCTCTAGTCCTTGCACT
>probe:Drosophila_2:1639731_at:633:501; Interrogation_Position=1422; Antisense; GTCCTTGCACTATCCAAACCGAAAG
>probe:Drosophila_2:1639731_at:547:427; Interrogation_Position=1517; Antisense; GAGATACGCGTATCTGCATACAGAT
>probe:Drosophila_2:1639731_at:241:533; Interrogation_Position=1567; Antisense; GGTGGCCACAATTCAATTCTGACTT
>probe:Drosophila_2:1639731_at:191:641; Interrogation_Position=1584; Antisense; TCTGACTTCATCGTACACATTCCAA
>probe:Drosophila_2:1639731_at:105:197; Interrogation_Position=1614; Antisense; AACGGCAACGTACTCGAGCACGGAA
>probe:Drosophila_2:1639731_at:63:727; Interrogation_Position=1681; Antisense; TTGTATCTACACGTATCCAACGCTT
>probe:Drosophila_2:1639731_at:195:389; Interrogation_Position=1707; Antisense; GAAAACTGATTAATCCGCGCGCGGA
>probe:Drosophila_2:1639731_at:635:631; Interrogation_Position=1720; Antisense; TCCGCGCGCGGACAATAAATCAATG

Paste this into a BLAST search page for me
TAGTTTTAGTTATTCCTTTGCCATACTTTGCCATATTTCTTCTCTAGTCAGTTCCCAAGCTGAATTCTATCTCACGTTGATTTTCACCACATATTTACTTATGCACTGTTCTGTTCTCATTTAGATTGTAAACTCTCTAGTCCTTGCACTGTCCTTGCACTATCCAAACCGAAAGGAGATACGCGTATCTGCATACAGATGGTGGCCACAATTCAATTCTGACTTTCTGACTTCATCGTACACATTCCAAAACGGCAACGTACTCGAGCACGGAATTGTATCTACACGTATCCAACGCTTGAAAACTGATTAATCCGCGCGCGGATCCGCGCGCGGACAATAAATCAATG

Full Affymetrix probeset data:

Annotations for 1639731_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime