Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639733_s_at:

>probe:Drosophila_2:1639733_s_at:157:11; Interrogation_Position=264; Antisense; ATTCGGTGCCATCAGTGTAATTCGC
>probe:Drosophila_2:1639733_s_at:194:533; Interrogation_Position=306; Antisense; GGTGGCCTGGTGGTGAACACTCCTC
>probe:Drosophila_2:1639733_s_at:266:81; Interrogation_Position=339; Antisense; AGGGACAACCAGTACCTGACGGACT
>probe:Drosophila_2:1639733_s_at:56:511; Interrogation_Position=379; Antisense; GTGAGGTGGCCTTCTGCCGCAAGAC
>probe:Drosophila_2:1639733_s_at:207:379; Interrogation_Position=445; Antisense; GAAGCTGTGGTTTCATTCCGGAGAA
>probe:Drosophila_2:1639733_s_at:112:209; Interrogation_Position=510; Antisense; AAGCAGATCATTTGCACCTGTCCCG
>probe:Drosophila_2:1639733_s_at:274:467; Interrogation_Position=578; Antisense; GTTGGGCTACAGTCTGGTTGGATCT
>probe:Drosophila_2:1639733_s_at:370:467; Interrogation_Position=594; Antisense; GTTGGATCTGTCGTCAGTCTGGCAC
>probe:Drosophila_2:1639733_s_at:729:141; Interrogation_Position=617; Antisense; ACTGGCCAGCATGCTCAGGCATTAG
>probe:Drosophila_2:1639733_s_at:392:569; Interrogation_Position=634; Antisense; GGCATTAGGTCATCGATCAGCTCAC
>probe:Drosophila_2:1639733_s_at:270:619; Interrogation_Position=669; Antisense; TGCATCCTGTTTTCTCCATTCAAAA
>probe:Drosophila_2:1639733_s_at:528:279; Interrogation_Position=739; Antisense; CTAAGTTCTTTGCTGTTTGCCATAT
>probe:Drosophila_2:1639733_s_at:366:29; Interrogation_Position=774; Antisense; ATACGTGGCAGCTATTTCGCGTTTA
>probe:Drosophila_2:1639733_s_at:440:717; Interrogation_Position=789; Antisense; TTCGCGTTTAGTCTTGTATTCTGTA

Paste this into a BLAST search page for me
ATTCGGTGCCATCAGTGTAATTCGCGGTGGCCTGGTGGTGAACACTCCTCAGGGACAACCAGTACCTGACGGACTGTGAGGTGGCCTTCTGCCGCAAGACGAAGCTGTGGTTTCATTCCGGAGAAAAGCAGATCATTTGCACCTGTCCCGGTTGGGCTACAGTCTGGTTGGATCTGTTGGATCTGTCGTCAGTCTGGCACACTGGCCAGCATGCTCAGGCATTAGGGCATTAGGTCATCGATCAGCTCACTGCATCCTGTTTTCTCCATTCAAAACTAAGTTCTTTGCTGTTTGCCATATATACGTGGCAGCTATTTCGCGTTTATTCGCGTTTAGTCTTGTATTCTGTA

Full Affymetrix probeset data:

Annotations for 1639733_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime