FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639734_at:

>probe:Drosophila_2:1639734_at:582:349; Interrogation_Position=1006; Antisense; GCAGATCTTCAATACAGCCGTGGGT
>probe:Drosophila_2:1639734_at:573:327; Interrogation_Position=1039; Antisense; GCGGCGTTATGGAACTCGGTACACT
>probe:Drosophila_2:1639734_at:336:683; Interrogation_Position=1086; Antisense; TATATCCGGCAGCTGGTTCCAGTAT
>probe:Drosophila_2:1639734_at:430:531; Interrogation_Position=1125; Antisense; GGGTGCTCAACGTTAAGTACTCCTT
>probe:Drosophila_2:1639734_at:299:669; Interrogation_Position=1154; Antisense; TACGAGCTACGACCGTCTGGGTATA
>probe:Drosophila_2:1639734_at:59:559; Interrogation_Position=1185; Antisense; GGACAGGATTTAGATTGCCCGCCGC
>probe:Drosophila_2:1639734_at:1:13; Interrogation_Position=1259; Antisense; ATTAAGGCTGCTGCTCAAATCGAGG
>probe:Drosophila_2:1639734_at:23:385; Interrogation_Position=751; Antisense; GAACTGCGTTGGAACGGATCCCAAT
>probe:Drosophila_2:1639734_at:212:715; Interrogation_Position=814; Antisense; TTCTGATCCCTGCTCGGAGTCATAT
>probe:Drosophila_2:1639734_at:281:89; Interrogation_Position=831; Antisense; AGTCATATGCTGGACCCAAGGCGTT
>probe:Drosophila_2:1639734_at:474:69; Interrogation_Position=849; Antisense; AGGCGTTCTCCGAACCTGAAGTTCA
>probe:Drosophila_2:1639734_at:714:373; Interrogation_Position=866; Antisense; GAAGTTCAGACTCTTTCTCAGTTTT
>probe:Drosophila_2:1639734_at:147:159; Interrogation_Position=893; Antisense; AAATCGGTGCCGGAACCCATGTTCA
>probe:Drosophila_2:1639734_at:7:633; Interrogation_Position=941; Antisense; TCCCAATTGTTGCTATATCCCTATG

Paste this into a BLAST search page for me
GCAGATCTTCAATACAGCCGTGGGTGCGGCGTTATGGAACTCGGTACACTTATATCCGGCAGCTGGTTCCAGTATGGGTGCTCAACGTTAAGTACTCCTTTACGAGCTACGACCGTCTGGGTATAGGACAGGATTTAGATTGCCCGCCGCATTAAGGCTGCTGCTCAAATCGAGGGAACTGCGTTGGAACGGATCCCAATTTCTGATCCCTGCTCGGAGTCATATAGTCATATGCTGGACCCAAGGCGTTAGGCGTTCTCCGAACCTGAAGTTCAGAAGTTCAGACTCTTTCTCAGTTTTAAATCGGTGCCGGAACCCATGTTCATCCCAATTGTTGCTATATCCCTATG

Full Affymetrix probeset data:

Annotations for 1639734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720