FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639735_at:

>probe:Drosophila_2:1639735_at:229:73; Interrogation_Position=1768; Antisense; AGGAGGATGAGACCTTCTAAGGCGC
>probe:Drosophila_2:1639735_at:575:529; Interrogation_Position=2133; Antisense; GGGATGCTCGAAATTGTTACATAGT
>probe:Drosophila_2:1639735_at:662:281; Interrogation_Position=2139; Antisense; CTCGAAATTGTTACATAGTAGCACA
>probe:Drosophila_2:1639735_at:170:475; Interrogation_Position=2148; Antisense; GTTACATAGTAGCACAATTTTACAA
>probe:Drosophila_2:1639735_at:391:679; Interrogation_Position=2175; Antisense; TAGTAGAAATTATTGTTGCCACCCG
>probe:Drosophila_2:1639735_at:208:475; Interrogation_Position=2177; Antisense; GTAGAAATTATTGTTGCCACCCGAA
>probe:Drosophila_2:1639735_at:83:105; Interrogation_Position=2179; Antisense; AGAAATTATTGTTGCCACCCGAAAG
>probe:Drosophila_2:1639735_at:668:393; Interrogation_Position=2180; Antisense; GAAATTATTGTTGCCACCCGAAAGG
>probe:Drosophila_2:1639735_at:565:1; Interrogation_Position=2183; Antisense; ATTATTGTTGCCACCCGAAAGGAAG
>probe:Drosophila_2:1639735_at:415:603; Interrogation_Position=2188; Antisense; TGTTGCCACCCGAAAGGAAGGAAAT
>probe:Drosophila_2:1639735_at:718:309; Interrogation_Position=2191; Antisense; TGCCACCCGAAAGGAAGGAAATCCT
>probe:Drosophila_2:1639735_at:498:223; Interrogation_Position=2205; Antisense; AAGGAAATCCTAGAATGCAAACCAG
>probe:Drosophila_2:1639735_at:39:359; Interrogation_Position=2217; Antisense; GAATGCAAACCAGGATAAAAACGAA
>probe:Drosophila_2:1639735_at:193:297; Interrogation_Position=2238; Antisense; CGAAGTAATGACGTTTGTGAAATTT

Paste this into a BLAST search page for me
AGGAGGATGAGACCTTCTAAGGCGCGGGATGCTCGAAATTGTTACATAGTCTCGAAATTGTTACATAGTAGCACAGTTACATAGTAGCACAATTTTACAATAGTAGAAATTATTGTTGCCACCCGGTAGAAATTATTGTTGCCACCCGAAAGAAATTATTGTTGCCACCCGAAAGGAAATTATTGTTGCCACCCGAAAGGATTATTGTTGCCACCCGAAAGGAAGTGTTGCCACCCGAAAGGAAGGAAATTGCCACCCGAAAGGAAGGAAATCCTAAGGAAATCCTAGAATGCAAACCAGGAATGCAAACCAGGATAAAAACGAACGAAGTAATGACGTTTGTGAAATTT

Full Affymetrix probeset data:

Annotations for 1639735_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720