FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639736_at:

>probe:Drosophila_2:1639736_at:492:539; Interrogation_Position=1016; Antisense; GGTTCAGCTATACCGTCAGCTCAAA
>probe:Drosophila_2:1639736_at:582:653; Interrogation_Position=1121; Antisense; TAATCCCTTAAGTTTCGTGAATGCG
>probe:Drosophila_2:1639736_at:521:611; Interrogation_Position=1138; Antisense; TGAATGCGTTTGCTACCCACTGAAG
>probe:Drosophila_2:1639736_at:558:233; Interrogation_Position=684; Antisense; AATGCCGGGCCAACAGAATTCAAAC
>probe:Drosophila_2:1639736_at:126:21; Interrogation_Position=722; Antisense; ATTTGGTGAGATCGTCCATGCCCCA
>probe:Drosophila_2:1639736_at:705:181; Interrogation_Position=780; Antisense; AAAAGTGAAACCGTGCCGCGTCCAG
>probe:Drosophila_2:1639736_at:547:173; Interrogation_Position=810; Antisense; AAAGCCAATCTCCTTCTAAAGTCCA
>probe:Drosophila_2:1639736_at:697:219; Interrogation_Position=828; Antisense; AAGTCCATGCTGAATCCCGACCAGG
>probe:Drosophila_2:1639736_at:293:1; Interrogation_Position=847; Antisense; ACCAGGGTCAGTCAAATCGTGGGCC
>probe:Drosophila_2:1639736_at:146:89; Interrogation_Position=888; Antisense; AGTCGACTAAAGCTGGCTGCCCAAT
>probe:Drosophila_2:1639736_at:388:621; Interrogation_Position=905; Antisense; TGCCCAATCTAAGAGCGCCTTCAAA
>probe:Drosophila_2:1639736_at:318:201; Interrogation_Position=957; Antisense; AAGCGGAAAGATCTGCCCTTGGCTA
>probe:Drosophila_2:1639736_at:466:321; Interrogation_Position=971; Antisense; GCCCTTGGCTACGAGGTCAATGCTT
>probe:Drosophila_2:1639736_at:24:495; Interrogation_Position=986; Antisense; GTCAATGCTTGAAACCGAGCGCAGC

Paste this into a BLAST search page for me
GGTTCAGCTATACCGTCAGCTCAAATAATCCCTTAAGTTTCGTGAATGCGTGAATGCGTTTGCTACCCACTGAAGAATGCCGGGCCAACAGAATTCAAACATTTGGTGAGATCGTCCATGCCCCAAAAAGTGAAACCGTGCCGCGTCCAGAAAGCCAATCTCCTTCTAAAGTCCAAAGTCCATGCTGAATCCCGACCAGGACCAGGGTCAGTCAAATCGTGGGCCAGTCGACTAAAGCTGGCTGCCCAATTGCCCAATCTAAGAGCGCCTTCAAAAAGCGGAAAGATCTGCCCTTGGCTAGCCCTTGGCTACGAGGTCAATGCTTGTCAATGCTTGAAACCGAGCGCAGC

Full Affymetrix probeset data:

Annotations for 1639736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720