FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639737_at:

>probe:Drosophila_2:1639737_at:523:293; Interrogation_Position=129; Antisense; CGATTTCCCGCAAGAGAGCAAGCAA
>probe:Drosophila_2:1639737_at:393:421; Interrogation_Position=144; Antisense; GAGCAAGCAACAGCATGTGGTCGAA
>probe:Drosophila_2:1639737_at:372:519; Interrogation_Position=160; Antisense; GTGGTCGAAAATTGCCATCGCCGGA
>probe:Drosophila_2:1639737_at:698:605; Interrogation_Position=195; Antisense; TGATGGGTGGCGTCCTGTCCTCCAG
>probe:Drosophila_2:1639737_at:481:67; Interrogation_Position=273; Antisense; AGGCAAAGGCCTTCCAAGTGAAACA
>probe:Drosophila_2:1639737_at:610:535; Interrogation_Position=322; Antisense; GGTTTTCTCAAGTGGATCCCGACTG
>probe:Drosophila_2:1639737_at:650:581; Interrogation_Position=345; Antisense; TGGCTGTGTCGATTAGGCAGTTCCT
>probe:Drosophila_2:1639737_at:695:711; Interrogation_Position=390; Antisense; TTCACTCGGCAGCTGGGATATCTAC
>probe:Drosophila_2:1639737_at:33:531; Interrogation_Position=404; Antisense; GGGATATCTACTGGCCAGCCGGCTA
>probe:Drosophila_2:1639737_at:311:669; Interrogation_Position=427; Antisense; TACTCTGGCTTGTGTTTGAGCTACA
>probe:Drosophila_2:1639737_at:20:33; Interrogation_Position=487; Antisense; ATCAAGTCGATGCACCCGCTGGGAA
>probe:Drosophila_2:1639737_at:553:561; Interrogation_Position=530; Antisense; GGAACAATTCGAGCACTAAACTTTA
>probe:Drosophila_2:1639737_at:133:551; Interrogation_Position=601; Antisense; GGAGTTCCCTATGCGTAAGCAATAA
>probe:Drosophila_2:1639737_at:460:549; Interrogation_Position=98; Antisense; GGAGTAGTGTCCAGTCACTCGTCAC

Paste this into a BLAST search page for me
CGATTTCCCGCAAGAGAGCAAGCAAGAGCAAGCAACAGCATGTGGTCGAAGTGGTCGAAAATTGCCATCGCCGGATGATGGGTGGCGTCCTGTCCTCCAGAGGCAAAGGCCTTCCAAGTGAAACAGGTTTTCTCAAGTGGATCCCGACTGTGGCTGTGTCGATTAGGCAGTTCCTTTCACTCGGCAGCTGGGATATCTACGGGATATCTACTGGCCAGCCGGCTATACTCTGGCTTGTGTTTGAGCTACAATCAAGTCGATGCACCCGCTGGGAAGGAACAATTCGAGCACTAAACTTTAGGAGTTCCCTATGCGTAAGCAATAAGGAGTAGTGTCCAGTCACTCGTCAC

Full Affymetrix probeset data:

Annotations for 1639737_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720