FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639741_at:

>probe:Drosophila_2:1639741_at:376:667; Interrogation_Position=372; Antisense; TACATGAACGCCGTCAGCGAGATCT
>probe:Drosophila_2:1639741_at:516:427; Interrogation_Position=390; Antisense; GAGATCTCCCGTGTGATGGCCTGCA
>probe:Drosophila_2:1639741_at:134:527; Interrogation_Position=437; Antisense; GGGCAAGACAGTGATGACCCATCTG
>probe:Drosophila_2:1639741_at:449:39; Interrogation_Position=457; Antisense; ATCTGGGCGTCGAGTTCCAGCGCAT
>probe:Drosophila_2:1639741_at:727:51; Interrogation_Position=480; Antisense; ATGCTGCAGGCCGATCAGGTCCAGA
>probe:Drosophila_2:1639741_at:271:65; Interrogation_Position=496; Antisense; AGGTCCAGACTTCTGTTACAACCTC
>probe:Drosophila_2:1639741_at:576:455; Interrogation_Position=564; Antisense; GATAACGAGGACTCTCAATCCGCCG
>probe:Drosophila_2:1639741_at:643:499; Interrogation_Position=603; Antisense; GTCGAAGAAACCATGTGGCGCCCTT
>probe:Drosophila_2:1639741_at:528:63; Interrogation_Position=615; Antisense; ATGTGGCGCCCTTGGTAAATCACCA
>probe:Drosophila_2:1639741_at:316:43; Interrogation_Position=657; Antisense; ATCGAATCCAGTCTTCCAGCTGAAG
>probe:Drosophila_2:1639741_at:254:111; Interrogation_Position=680; Antisense; AGAATCTTCTTCAGCATCGACATTG
>probe:Drosophila_2:1639741_at:592:43; Interrogation_Position=695; Antisense; ATCGACATTGAATCCTGTCTTCCAC
>probe:Drosophila_2:1639741_at:495:335; Interrogation_Position=731; Antisense; GCTGCAACGAATCATGTCTTCCAAT
>probe:Drosophila_2:1639741_at:278:355; Interrogation_Position=798; Antisense; GCACACCTCAAGCTTTATTAGTTTA

Paste this into a BLAST search page for me
TACATGAACGCCGTCAGCGAGATCTGAGATCTCCCGTGTGATGGCCTGCAGGGCAAGACAGTGATGACCCATCTGATCTGGGCGTCGAGTTCCAGCGCATATGCTGCAGGCCGATCAGGTCCAGAAGGTCCAGACTTCTGTTACAACCTCGATAACGAGGACTCTCAATCCGCCGGTCGAAGAAACCATGTGGCGCCCTTATGTGGCGCCCTTGGTAAATCACCAATCGAATCCAGTCTTCCAGCTGAAGAGAATCTTCTTCAGCATCGACATTGATCGACATTGAATCCTGTCTTCCACGCTGCAACGAATCATGTCTTCCAATGCACACCTCAAGCTTTATTAGTTTA

Full Affymetrix probeset data:

Annotations for 1639741_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720