FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639742_at:

>probe:Drosophila_2:1639742_at:94:71; Interrogation_Position=1843; Antisense; AGGCGCATAGTCTTTTGCAGCTTCG
>probe:Drosophila_2:1639742_at:127:151; Interrogation_Position=1874; Antisense; ACATCTGTGCCATGGTTCGGTTTAA
>probe:Drosophila_2:1639742_at:368:483; Interrogation_Position=1906; Antisense; GTATATCCCGTGACTTTACTACTGG
>probe:Drosophila_2:1639742_at:211:635; Interrogation_Position=1942; Antisense; TCGCCGGTTCAGTATGCAGACCAAA
>probe:Drosophila_2:1639742_at:589:187; Interrogation_Position=2002; Antisense; AACAGTCTGGAGTTCCTTGGGCTGA
>probe:Drosophila_2:1639742_at:417:613; Interrogation_Position=2048; Antisense; TGAACAAGCCCTCGACTATGGCATA
>probe:Drosophila_2:1639742_at:566:679; Interrogation_Position=2064; Antisense; TATGGCATACCTGCACCAGATCAAT
>probe:Drosophila_2:1639742_at:430:237; Interrogation_Position=2086; Antisense; AATCTGGACGCTTTTGTTTATGGTA
>probe:Drosophila_2:1639742_at:146:539; Interrogation_Position=2107; Antisense; GGTAGTTCCACCATTGACCTGGAGA
>probe:Drosophila_2:1639742_at:150:365; Interrogation_Position=2165; Antisense; GAATAATCTACGATCGTCTCGACCA
>probe:Drosophila_2:1639742_at:378:559; Interrogation_Position=2220; Antisense; GGACACCATGTGCACCATTGATTCA
>probe:Drosophila_2:1639742_at:697:461; Interrogation_Position=2239; Antisense; GATTCAGTGACCACAAGGCGCGTGA
>probe:Drosophila_2:1639742_at:254:79; Interrogation_Position=2312; Antisense; CGGAAACTTCCATCGTCGTACATAA
>probe:Drosophila_2:1639742_at:575:35; Interrogation_Position=2344; Antisense; ATCGACTGATGGTTTTCCCCACGTT

Paste this into a BLAST search page for me
AGGCGCATAGTCTTTTGCAGCTTCGACATCTGTGCCATGGTTCGGTTTAAGTATATCCCGTGACTTTACTACTGGTCGCCGGTTCAGTATGCAGACCAAAAACAGTCTGGAGTTCCTTGGGCTGATGAACAAGCCCTCGACTATGGCATATATGGCATACCTGCACCAGATCAATAATCTGGACGCTTTTGTTTATGGTAGGTAGTTCCACCATTGACCTGGAGAGAATAATCTACGATCGTCTCGACCAGGACACCATGTGCACCATTGATTCAGATTCAGTGACCACAAGGCGCGTGACGGAAACTTCCATCGTCGTACATAAATCGACTGATGGTTTTCCCCACGTT

Full Affymetrix probeset data:

Annotations for 1639742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720