Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639745_at:

>probe:Drosophila_2:1639745_at:385:537; Interrogation_Position=112; Antisense; GGTCTTCGCGGCTGGTGCATGAACT
>probe:Drosophila_2:1639745_at:367:67; Interrogation_Position=13; Antisense; ATGGCGACCCATAATGTCCATTCCT
>probe:Drosophila_2:1639745_at:390:523; Interrogation_Position=144; Antisense; GGGCACCGTGAAGGGTTACATCGAA
>probe:Drosophila_2:1639745_at:379:707; Interrogation_Position=159; Antisense; TTACATCGAAGGTCGTCCGGCCGAG
>probe:Drosophila_2:1639745_at:498:519; Interrogation_Position=244; Antisense; GTGGAGTTCAGTTCTCAGCGTGAGC
>probe:Drosophila_2:1639745_at:718:229; Interrogation_Position=25; Antisense; AATGTCCATTCCTGCGAATTCGAGG
>probe:Drosophila_2:1639745_at:51:125; Interrogation_Position=266; Antisense; AGCGCGATCGCTATGGCTATGCCAA
>probe:Drosophila_2:1639745_at:194:49; Interrogation_Position=284; Antisense; ATGCCAACTTTCATATCAAGCCCGA
>probe:Drosophila_2:1639745_at:596:683; Interrogation_Position=297; Antisense; TATCAAGCCCGATCCGCACGAGAAT
>probe:Drosophila_2:1639745_at:252:137; Interrogation_Position=314; Antisense; ACGAGAATCGCCCAGTTCATGAAGG
>probe:Drosophila_2:1639745_at:502:485; Interrogation_Position=347; Antisense; GTAGTTCCAGCCACCATGATAGCAA
>probe:Drosophila_2:1639745_at:214:363; Interrogation_Position=40; Antisense; GAATTCGAGGTATTTGGCCGCGTGC
>probe:Drosophila_2:1639745_at:654:617; Interrogation_Position=62; Antisense; TGCAGGGCGTCAACTTCCGGCGACA
>probe:Drosophila_2:1639745_at:616:225; Interrogation_Position=97; Antisense; AAGGCCAAGACACTGGGTCTTCGCG

Paste this into a BLAST search page for me
GGTCTTCGCGGCTGGTGCATGAACTATGGCGACCCATAATGTCCATTCCTGGGCACCGTGAAGGGTTACATCGAATTACATCGAAGGTCGTCCGGCCGAGGTGGAGTTCAGTTCTCAGCGTGAGCAATGTCCATTCCTGCGAATTCGAGGAGCGCGATCGCTATGGCTATGCCAAATGCCAACTTTCATATCAAGCCCGATATCAAGCCCGATCCGCACGAGAATACGAGAATCGCCCAGTTCATGAAGGGTAGTTCCAGCCACCATGATAGCAAGAATTCGAGGTATTTGGCCGCGTGCTGCAGGGCGTCAACTTCCGGCGACAAAGGCCAAGACACTGGGTCTTCGCG

Full Affymetrix probeset data:

Annotations for 1639745_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime