Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639746_at:

>probe:Drosophila_2:1639746_at:299:15; Interrogation_Position=1225; Antisense; ATTTTGCAAAGATCACGTCCACACC
>probe:Drosophila_2:1639746_at:459:87; Interrogation_Position=1256; Antisense; AGTGCCTTCATCCATTCAGATGCCA
>probe:Drosophila_2:1639746_at:309:647; Interrogation_Position=1271; Antisense; TCAGATGCCACTGCCAATTCAGAAT
>probe:Drosophila_2:1639746_at:719:359; Interrogation_Position=1292; Antisense; GAATACCAAGATCCTAAAGTCCGAG
>probe:Drosophila_2:1639746_at:567:303; Interrogation_Position=1372; Antisense; CCGACTTCCGCTTCCTAATGAAAAT
>probe:Drosophila_2:1639746_at:47:671; Interrogation_Position=1399; Antisense; TACCCAAATTGGAACAGCTGCCCGA
>probe:Drosophila_2:1639746_at:688:293; Interrogation_Position=1421; Antisense; CGAGCCCCACAAGCAGAACGTGAAG
>probe:Drosophila_2:1639746_at:579:197; Interrogation_Position=1437; Antisense; AACGTGAAGCGTTCCATCCAGATCT
>probe:Drosophila_2:1639746_at:611:375; Interrogation_Position=1469; Antisense; GAAGAGCTACAGTATTTACGGCAAC
>probe:Drosophila_2:1639746_at:565:475; Interrogation_Position=1502; Antisense; GTTATCAGTATTTTCGGGCACAGCG
>probe:Drosophila_2:1639746_at:115:355; Interrogation_Position=1519; Antisense; GCACAGCGTTTATTTTCCATTTCAT
>probe:Drosophila_2:1639746_at:627:113; Interrogation_Position=1548; Antisense; AGCAGTTCCCTTTATTTTCGTACAT
>probe:Drosophila_2:1639746_at:667:113; Interrogation_Position=1660; Antisense; AGCAGCTCCCCATTTAGACATGTAA
>probe:Drosophila_2:1639746_at:563:691; Interrogation_Position=1697; Antisense; TTTGATATTACCCACCTGGAGATGG

Paste this into a BLAST search page for me
ATTTTGCAAAGATCACGTCCACACCAGTGCCTTCATCCATTCAGATGCCATCAGATGCCACTGCCAATTCAGAATGAATACCAAGATCCTAAAGTCCGAGCCGACTTCCGCTTCCTAATGAAAATTACCCAAATTGGAACAGCTGCCCGACGAGCCCCACAAGCAGAACGTGAAGAACGTGAAGCGTTCCATCCAGATCTGAAGAGCTACAGTATTTACGGCAACGTTATCAGTATTTTCGGGCACAGCGGCACAGCGTTTATTTTCCATTTCATAGCAGTTCCCTTTATTTTCGTACATAGCAGCTCCCCATTTAGACATGTAATTTGATATTACCCACCTGGAGATGG

Full Affymetrix probeset data:

Annotations for 1639746_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime