Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639747_at:

>probe:Drosophila_2:1639747_at:638:575; Interrogation_Position=1111; Antisense; GGCGATCAGGCCTACACTTTGCTGG
>probe:Drosophila_2:1639747_at:562:325; Interrogation_Position=1151; Antisense; GCGATCGCTTCCTGGACGAAATCTA
>probe:Drosophila_2:1639747_at:454:383; Interrogation_Position=1177; Antisense; GAACTGGAATCCTTTCTACGCATGC
>probe:Drosophila_2:1639747_at:148:51; Interrogation_Position=1198; Antisense; ATGCGTATCTACGAGCTCAAGCAGC
>probe:Drosophila_2:1639747_at:441:723; Interrogation_Position=1223; Antisense; TTGAATCCTCCAGCGACATCATGTT
>probe:Drosophila_2:1639747_at:644:471; Interrogation_Position=1245; Antisense; GTTCTCGCTGATGGACAACATTGCC
>probe:Drosophila_2:1639747_at:140:375; Interrogation_Position=1293; Antisense; GAAGATACTCGTGTCCGTGGAGAAA
>probe:Drosophila_2:1639747_at:172:241; Interrogation_Position=1317; Antisense; AATAATCCAGCAGACATCCGACAAG
>probe:Drosophila_2:1639747_at:712:375; Interrogation_Position=1365; Antisense; GAAGCACTCCCCAAAGTATGCCAAT
>probe:Drosophila_2:1639747_at:361:581; Interrogation_Position=1394; Antisense; TGGCCACCAAGCTGCAGCAAATGAC
>probe:Drosophila_2:1639747_at:225:71; Interrogation_Position=1451; Antisense; AGGCGCTCAAGCAGTTGACCATCGA
>probe:Drosophila_2:1639747_at:447:349; Interrogation_Position=1491; Antisense; GCAGGACCTGAATCCCGTGCTGGAG
>probe:Drosophila_2:1639747_at:429:75; Interrogation_Position=1514; Antisense; AGGAGCTGATTGCTCAGACTCGCAC
>probe:Drosophila_2:1639747_at:150:261; Interrogation_Position=1536; Antisense; CACGCTGCAGTCTCACATCGAGAAG

Paste this into a BLAST search page for me
GGCGATCAGGCCTACACTTTGCTGGGCGATCGCTTCCTGGACGAAATCTAGAACTGGAATCCTTTCTACGCATGCATGCGTATCTACGAGCTCAAGCAGCTTGAATCCTCCAGCGACATCATGTTGTTCTCGCTGATGGACAACATTGCCGAAGATACTCGTGTCCGTGGAGAAAAATAATCCAGCAGACATCCGACAAGGAAGCACTCCCCAAAGTATGCCAATTGGCCACCAAGCTGCAGCAAATGACAGGCGCTCAAGCAGTTGACCATCGAGCAGGACCTGAATCCCGTGCTGGAGAGGAGCTGATTGCTCAGACTCGCACCACGCTGCAGTCTCACATCGAGAAG

Full Affymetrix probeset data:

Annotations for 1639747_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime