FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639751_at:

>probe:Drosophila_2:1639751_at:73:209; Interrogation_Position=127; Antisense; CAAGTTGGTGGTTCGAACTACTTCG
>probe:Drosophila_2:1639751_at:358:193; Interrogation_Position=142; Antisense; AACTACTTCGATCTGATTCGCATGA
>probe:Drosophila_2:1639751_at:726:715; Interrogation_Position=16; Antisense; TTCGCGGAGTATGACATTGTCGACT
>probe:Drosophila_2:1639751_at:70:409; Interrogation_Position=165; Antisense; GACGAACAAGGATCTCTGCAAGCTC
>probe:Drosophila_2:1639751_at:130:631; Interrogation_Position=188; Antisense; TCCTCGATTCACTTCGCAATATTAC
>probe:Drosophila_2:1639751_at:234:723; Interrogation_Position=241; Antisense; TTGCCCTCGACTTTTGTTGTCTCAT
>probe:Drosophila_2:1639751_at:606:467; Interrogation_Position=256; Antisense; GTTGTCTCATGTCCTTTGGTTCCAG
>probe:Drosophila_2:1639751_at:291:539; Interrogation_Position=273; Antisense; GGTTCCAGGCTTCTATTTTGTTGAG
>probe:Drosophila_2:1639751_at:639:609; Interrogation_Position=308; Antisense; TTGATTCCAAACTGGTTCCTTTCCG
>probe:Drosophila_2:1639751_at:150:457; Interrogation_Position=347; Antisense; GATACATGGTACTTTTTGAGCTGAT
>probe:Drosophila_2:1639751_at:198:217; Interrogation_Position=415; Antisense; AAGTTTTCCATTAAGACACCACCTG
>probe:Drosophila_2:1639751_at:99:213; Interrogation_Position=427; Antisense; AAGACACCACCTGGATACACGGAAC
>probe:Drosophila_2:1639751_at:320:367; Interrogation_Position=57; Antisense; GAATCTCACAGTTCAAGTGCCCTTT
>probe:Drosophila_2:1639751_at:714:205; Interrogation_Position=88; Antisense; AAGCTTCTCATCCACATTTTCGTAA

Paste this into a BLAST search page for me
CAAGTTGGTGGTTCGAACTACTTCGAACTACTTCGATCTGATTCGCATGATTCGCGGAGTATGACATTGTCGACTGACGAACAAGGATCTCTGCAAGCTCTCCTCGATTCACTTCGCAATATTACTTGCCCTCGACTTTTGTTGTCTCATGTTGTCTCATGTCCTTTGGTTCCAGGGTTCCAGGCTTCTATTTTGTTGAGTTGATTCCAAACTGGTTCCTTTCCGGATACATGGTACTTTTTGAGCTGATAAGTTTTCCATTAAGACACCACCTGAAGACACCACCTGGATACACGGAACGAATCTCACAGTTCAAGTGCCCTTTAAGCTTCTCATCCACATTTTCGTAA

Full Affymetrix probeset data:

Annotations for 1639751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720