FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639752_at:

>probe:Drosophila_2:1639752_at:547:481; Interrogation_Position=3970; Antisense; GTATTTTAGCTCTTGAAAACGCAGA
>probe:Drosophila_2:1639752_at:534:337; Interrogation_Position=4075; Antisense; GCTCAAGTTACGATGGCACGTTCAA
>probe:Drosophila_2:1639752_at:155:261; Interrogation_Position=4091; Antisense; CACGTTCAACGTGCTTGAGTGACAA
>probe:Drosophila_2:1639752_at:515:375; Interrogation_Position=4131; Antisense; GAACTTCCAAAGTGTTCAGGCCAAA
>probe:Drosophila_2:1639752_at:235:279; Interrogation_Position=4146; Antisense; TCAGGCCAAAAGTAATTCTCCCCGA
>probe:Drosophila_2:1639752_at:196:245; Interrogation_Position=4159; Antisense; AATTCTCCCCGAACTAAAGAGCGAT
>probe:Drosophila_2:1639752_at:377:25; Interrogation_Position=4267; Antisense; ATATGTGTACATATTACTGCGTATT
>probe:Drosophila_2:1639752_at:661:669; Interrogation_Position=4281; Antisense; TACTGCGTATTTTCTATGTAGCTTA
>probe:Drosophila_2:1639752_at:378:487; Interrogation_Position=4298; Antisense; GTAGCTTATTTAGTTATCTTGATCT
>probe:Drosophila_2:1639752_at:540:35; Interrogation_Position=4313; Antisense; ATCTTGATCTAAGCAACGAATCGAA
>probe:Drosophila_2:1639752_at:213:689; Interrogation_Position=4345; Antisense; TTATCGAATGACTGAGACAAAGGCA
>probe:Drosophila_2:1639752_at:682:567; Interrogation_Position=4366; Antisense; GGCAGCGAATACTTTATACCAACAT
>probe:Drosophila_2:1639752_at:652:29; Interrogation_Position=4440; Antisense; ATAAACGTATTTTGTACACACCATA
>probe:Drosophila_2:1639752_at:60:491; Interrogation_Position=4453; Antisense; GTACACACCATATTGGCTAAGCAAT

Paste this into a BLAST search page for me
GTATTTTAGCTCTTGAAAACGCAGAGCTCAAGTTACGATGGCACGTTCAACACGTTCAACGTGCTTGAGTGACAAGAACTTCCAAAGTGTTCAGGCCAAATCAGGCCAAAAGTAATTCTCCCCGAAATTCTCCCCGAACTAAAGAGCGATATATGTGTACATATTACTGCGTATTTACTGCGTATTTTCTATGTAGCTTAGTAGCTTATTTAGTTATCTTGATCTATCTTGATCTAAGCAACGAATCGAATTATCGAATGACTGAGACAAAGGCAGGCAGCGAATACTTTATACCAACATATAAACGTATTTTGTACACACCATAGTACACACCATATTGGCTAAGCAAT

Full Affymetrix probeset data:

Annotations for 1639752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720