FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639753_at:

>probe:Drosophila_2:1639753_at:17:415; Interrogation_Position=2375; Antisense; GAGCCTCTCGGTTCGACAGCAAGCC
>probe:Drosophila_2:1639753_at:397:567; Interrogation_Position=2423; Antisense; GGCAGTTCAGCTTGGATCGCGACGA
>probe:Drosophila_2:1639753_at:486:589; Interrogation_Position=2435; Antisense; TGGATCGCGACGACCAGCAGGCGAA
>probe:Drosophila_2:1639753_at:1:535; Interrogation_Position=2533; Antisense; GGTGTCAAGAGCTCCATGCTGGACA
>probe:Drosophila_2:1639753_at:141:623; Interrogation_Position=2549; Antisense; TGCTGGACATACCTCTCTTGCACGA
>probe:Drosophila_2:1639753_at:62:397; Interrogation_Position=2572; Antisense; GACACTACTCGCAGTCCCAAGGGAA
>probe:Drosophila_2:1639753_at:412:659; Interrogation_Position=2600; Antisense; TAACGCGGTCCCACAAGCAGAACTC
>probe:Drosophila_2:1639753_at:511:97; Interrogation_Position=2651; Antisense; AGATCGAGGAGATCCCGCTGTCGCC
>probe:Drosophila_2:1639753_at:556:113; Interrogation_Position=2687; Antisense; AGCACCACAGTAGCCTGGACAGCAA
>probe:Drosophila_2:1639753_at:188:401; Interrogation_Position=2704; Antisense; GACAGCAATCTAAACCGCAGTCCGC
>probe:Drosophila_2:1639753_at:628:283; Interrogation_Position=2807; Antisense; CGTCCAGGACTTTGAACGGGATCTA
>probe:Drosophila_2:1639753_at:160:383; Interrogation_Position=2820; Antisense; GAACGGGATCTATGCCCACAACAGC
>probe:Drosophila_2:1639753_at:545:25; Interrogation_Position=2846; Antisense; ATAGTACCAGTTCCCATGGTGCAGC
>probe:Drosophila_2:1639753_at:654:101; Interrogation_Position=2901; Antisense; AGAGCTGACCCTTAATGCAGAGCAA

Paste this into a BLAST search page for me
GAGCCTCTCGGTTCGACAGCAAGCCGGCAGTTCAGCTTGGATCGCGACGATGGATCGCGACGACCAGCAGGCGAAGGTGTCAAGAGCTCCATGCTGGACATGCTGGACATACCTCTCTTGCACGAGACACTACTCGCAGTCCCAAGGGAATAACGCGGTCCCACAAGCAGAACTCAGATCGAGGAGATCCCGCTGTCGCCAGCACCACAGTAGCCTGGACAGCAAGACAGCAATCTAAACCGCAGTCCGCCGTCCAGGACTTTGAACGGGATCTAGAACGGGATCTATGCCCACAACAGCATAGTACCAGTTCCCATGGTGCAGCAGAGCTGACCCTTAATGCAGAGCAA

Full Affymetrix probeset data:

Annotations for 1639753_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720