FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639755_at:

>probe:Drosophila_2:1639755_at:705:253; Interrogation_Position=1011; Antisense; CAACGGAGTCCTGGATTACGGTCCT
>probe:Drosophila_2:1639755_at:532:653; Interrogation_Position=1043; Antisense; TCAATGGCCCGTTCTACATGTCGCA
>probe:Drosophila_2:1639755_at:584:355; Interrogation_Position=1071; Antisense; GCACTTCTTCCTCACAGATCAAATG
>probe:Drosophila_2:1639755_at:655:61; Interrogation_Position=1148; Antisense; ATGTGATAATGGAGCCCACTCTCGG
>probe:Drosophila_2:1639755_at:63:147; Interrogation_Position=1165; Antisense; ACTCTCGGCATTCCATTGAGCTTGA
>probe:Drosophila_2:1639755_at:427:527; Interrogation_Position=675; Antisense; GGGAAACTTTACACTGCACACTGGC
>probe:Drosophila_2:1639755_at:427:585; Interrogation_Position=741; Antisense; TGGAGAGAACACCACCGGCTTTTAT
>probe:Drosophila_2:1639755_at:511:699; Interrogation_Position=761; Antisense; TTTATCCCGGCGAATGCGGCAAGGT
>probe:Drosophila_2:1639755_at:404:21; Interrogation_Position=844; Antisense; ATATTCCTACCAGATGCAGCGCGGT
>probe:Drosophila_2:1639755_at:515:353; Interrogation_Position=859; Antisense; GCAGCGCGGTACTTGAACTTGTTTC
>probe:Drosophila_2:1639755_at:193:387; Interrogation_Position=889; Antisense; GAAAATCTCACCATAGACGGCATTG
>probe:Drosophila_2:1639755_at:367:61; Interrogation_Position=914; Antisense; ATGTCTGGCGATACGAGTCCACCAA
>probe:Drosophila_2:1639755_at:683:637; Interrogation_Position=947; Antisense; TCGATAATGGCCAGCTGTCGCCGGA
>probe:Drosophila_2:1639755_at:428:433; Interrogation_Position=976; Antisense; GAGTGCTTTTGCCTCAAGAATCGCG

Paste this into a BLAST search page for me
CAACGGAGTCCTGGATTACGGTCCTTCAATGGCCCGTTCTACATGTCGCAGCACTTCTTCCTCACAGATCAAATGATGTGATAATGGAGCCCACTCTCGGACTCTCGGCATTCCATTGAGCTTGAGGGAAACTTTACACTGCACACTGGCTGGAGAGAACACCACCGGCTTTTATTTTATCCCGGCGAATGCGGCAAGGTATATTCCTACCAGATGCAGCGCGGTGCAGCGCGGTACTTGAACTTGTTTCGAAAATCTCACCATAGACGGCATTGATGTCTGGCGATACGAGTCCACCAATCGATAATGGCCAGCTGTCGCCGGAGAGTGCTTTTGCCTCAAGAATCGCG

Full Affymetrix probeset data:

Annotations for 1639755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720