FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639757_at:

>probe:Drosophila_2:1639757_at:561:631; Interrogation_Position=1492; Antisense; TCCGGTGTTCCTGCAATTTATCGAT
>probe:Drosophila_2:1639757_at:570:429; Interrogation_Position=1556; Antisense; GAGTTCAACGAGCACTTCCTGATAA
>probe:Drosophila_2:1639757_at:468:203; Interrogation_Position=1579; Antisense; AACCATCGTGGATCATCTGTACTCG
>probe:Drosophila_2:1639757_at:588:105; Interrogation_Position=1668; Antisense; AGACAACATCCCTGTGGACGCACAT
>probe:Drosophila_2:1639757_at:262:33; Interrogation_Position=1691; Antisense; ATCAACTCGTCGCTGGACCAGTATT
>probe:Drosophila_2:1639757_at:377:555; Interrogation_Position=1705; Antisense; GGACCAGTATTTGAATCCACTCTTT
>probe:Drosophila_2:1639757_at:496:117; Interrogation_Position=1752; Antisense; AGCTAGTGCTGCGTCCGATTGCCAG
>probe:Drosophila_2:1639757_at:702:463; Interrogation_Position=1768; Antisense; GATTGCCAGCGTGAGATCGGTCCGC
>probe:Drosophila_2:1639757_at:138:41; Interrogation_Position=1783; Antisense; ATCGGTCCGCTTGTGGAAGGGCCTA
>probe:Drosophila_2:1639757_at:432:221; Interrogation_Position=1799; Antisense; AAGGGCCTATACTGTCGCTGGAATC
>probe:Drosophila_2:1639757_at:592:75; Interrogation_Position=1881; Antisense; AGGACCAGCTCTTTAAGCTCGTCAA
>probe:Drosophila_2:1639757_at:184:419; Interrogation_Position=1907; Antisense; GAGCTGCGGCTCAAGTCGAACAACC
>probe:Drosophila_2:1639757_at:593:53; Interrogation_Position=1943; Antisense; ATGCAGACAACTACGCGACTGGCCT
>probe:Drosophila_2:1639757_at:135:579; Interrogation_Position=1963; Antisense; GGCCTCGCCTATGCACTAATAGTAT

Paste this into a BLAST search page for me
TCCGGTGTTCCTGCAATTTATCGATGAGTTCAACGAGCACTTCCTGATAAAACCATCGTGGATCATCTGTACTCGAGACAACATCCCTGTGGACGCACATATCAACTCGTCGCTGGACCAGTATTGGACCAGTATTTGAATCCACTCTTTAGCTAGTGCTGCGTCCGATTGCCAGGATTGCCAGCGTGAGATCGGTCCGCATCGGTCCGCTTGTGGAAGGGCCTAAAGGGCCTATACTGTCGCTGGAATCAGGACCAGCTCTTTAAGCTCGTCAAGAGCTGCGGCTCAAGTCGAACAACCATGCAGACAACTACGCGACTGGCCTGGCCTCGCCTATGCACTAATAGTAT

Full Affymetrix probeset data:

Annotations for 1639757_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720