FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639758_at:

>probe:Drosophila_2:1639758_at:131:55; Interrogation_Position=1122; Antisense; ATGCAACGAGCTGAGGGATCCCACA
>probe:Drosophila_2:1639758_at:501:81; Interrogation_Position=1135; Antisense; AGGGATCCCACATACAGTCACTTTG
>probe:Drosophila_2:1639758_at:308:215; Interrogation_Position=1186; Antisense; AAGATGTTCTTCTACATCGCCTGCT
>probe:Drosophila_2:1639758_at:590:59; Interrogation_Position=1213; Antisense; ATGTATGTGCTCTATCTGGTGCTGT
>probe:Drosophila_2:1639758_at:252:627; Interrogation_Position=1271; Antisense; TGCCGTACTTTGATATGCGCTTGAA
>probe:Drosophila_2:1639758_at:307:691; Interrogation_Position=1357; Antisense; TTTGGCTTCGGCATCCTGGAGGATA
>probe:Drosophila_2:1639758_at:614:77; Interrogation_Position=1376; Antisense; AGGATAACTTTGTCGCCTCACTTAA
>probe:Drosophila_2:1639758_at:657:471; Interrogation_Position=1415; Antisense; GTTCGGCGCAGTTTATGTGCTTCTA
>probe:Drosophila_2:1639758_at:425:277; Interrogation_Position=1433; Antisense; GCTTCTACGGACTGCTTAACTTTTA
>probe:Drosophila_2:1639758_at:388:699; Interrogation_Position=1454; Antisense; TTTACCTGTACACCATGGCGTATGT
>probe:Drosophila_2:1639758_at:676:61; Interrogation_Position=1475; Antisense; ATGTGTACTCGCCAGATGGACGGTT
>probe:Drosophila_2:1639758_at:386:331; Interrogation_Position=1507; Antisense; GCGGAGCTGGCTGTCACCAAGGATA
>probe:Drosophila_2:1639758_at:468:631; Interrogation_Position=1533; Antisense; TCCGGCTATTTCCATGATCGACGAT
>probe:Drosophila_2:1639758_at:505:75; Interrogation_Position=1565; Antisense; AGGATGTTGTCTACGGTTCCGACGA

Paste this into a BLAST search page for me
ATGCAACGAGCTGAGGGATCCCACAAGGGATCCCACATACAGTCACTTTGAAGATGTTCTTCTACATCGCCTGCTATGTATGTGCTCTATCTGGTGCTGTTGCCGTACTTTGATATGCGCTTGAATTTGGCTTCGGCATCCTGGAGGATAAGGATAACTTTGTCGCCTCACTTAAGTTCGGCGCAGTTTATGTGCTTCTAGCTTCTACGGACTGCTTAACTTTTATTTACCTGTACACCATGGCGTATGTATGTGTACTCGCCAGATGGACGGTTGCGGAGCTGGCTGTCACCAAGGATATCCGGCTATTTCCATGATCGACGATAGGATGTTGTCTACGGTTCCGACGA

Full Affymetrix probeset data:

Annotations for 1639758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720