Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639761_s_at:

>probe:Drosophila_2:1639761_s_at:88:333; Interrogation_Position=1009; Antisense; GCTGACTATAGCACCTACTACTCTA
>probe:Drosophila_2:1639761_s_at:116:667; Interrogation_Position=1027; Antisense; TACTCTACCTAACCCGAAATTCTAT
>probe:Drosophila_2:1639761_s_at:218:31; Interrogation_Position=1094; Antisense; ATAAACGCAAACTCAGTCGAAACGG
>probe:Drosophila_2:1639761_s_at:422:501; Interrogation_Position=538; Antisense; GTCCTGCACCGTTCTCTAAGGAGGC
>probe:Drosophila_2:1639761_s_at:387:291; Interrogation_Position=579; Antisense; CGTTGCCGAGGAGTCAGCGATCGCC
>probe:Drosophila_2:1639761_s_at:56:45; Interrogation_Position=598; Antisense; ATCGCCGGCGGACGTTTAGCTTATT
>probe:Drosophila_2:1639761_s_at:269:139; Interrogation_Position=653; Antisense; ACGTGTGTGGAGTACTACCCCAGTA
>probe:Drosophila_2:1639761_s_at:405:483; Interrogation_Position=681; Antisense; GTATCAACGCCACCTGGAACAATAT
>probe:Drosophila_2:1639761_s_at:54:379; Interrogation_Position=717; Antisense; GAAGCCACAAAAGCTACGATTGTCA
>probe:Drosophila_2:1639761_s_at:404:61; Interrogation_Position=827; Antisense; ATGTGTACCAGCCACGTTAACAAGT
>probe:Drosophila_2:1639761_s_at:64:455; Interrogation_Position=931; Antisense; GATATCAGAGTTGTTTCCTTTCCGA
>probe:Drosophila_2:1639761_s_at:51:479; Interrogation_Position=943; Antisense; GTTTCCTTTCCGATGAGTAACGCAG
>probe:Drosophila_2:1639761_s_at:437:229; Interrogation_Position=970; Antisense; AATGTACACGAATATCCCAACTATA
>probe:Drosophila_2:1639761_s_at:252:199; Interrogation_Position=994; Antisense; AACGACAATTAATGCGCTGACTATA

Paste this into a BLAST search page for me
GCTGACTATAGCACCTACTACTCTATACTCTACCTAACCCGAAATTCTATATAAACGCAAACTCAGTCGAAACGGGTCCTGCACCGTTCTCTAAGGAGGCCGTTGCCGAGGAGTCAGCGATCGCCATCGCCGGCGGACGTTTAGCTTATTACGTGTGTGGAGTACTACCCCAGTAGTATCAACGCCACCTGGAACAATATGAAGCCACAAAAGCTACGATTGTCAATGTGTACCAGCCACGTTAACAAGTGATATCAGAGTTGTTTCCTTTCCGAGTTTCCTTTCCGATGAGTAACGCAGAATGTACACGAATATCCCAACTATAAACGACAATTAATGCGCTGACTATA

Full Affymetrix probeset data:

Annotations for 1639761_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime