FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639762_at:

>probe:Drosophila_2:1639762_at:97:369; Interrogation_Position=1044; Antisense; GAATGATCTTATTGGCGTTGCTGGA
>probe:Drosophila_2:1639762_at:367:117; Interrogation_Position=1093; Antisense; AGCGGTGGCAAGTGCTACGACCTTA
>probe:Drosophila_2:1639762_at:203:13; Interrogation_Position=1129; Antisense; ATTACTGCATTACTTCTGGACACTA
>probe:Drosophila_2:1639762_at:127:359; Interrogation_Position=1163; Antisense; GCAACATTATGCGTCAGTGGATCTT
>probe:Drosophila_2:1639762_at:318:83; Interrogation_Position=1178; Antisense; AGTGGATCTTCCAGACCTGCAATGA
>probe:Drosophila_2:1639762_at:497:541; Interrogation_Position=1207; Antisense; GGTTGGTATCAGACCTCTGGTTCTA
>probe:Drosophila_2:1639762_at:464:539; Interrogation_Position=1225; Antisense; GGTTCTAGTGCCCAACCATTTGGTA
>probe:Drosophila_2:1639762_at:203:305; Interrogation_Position=1258; Antisense; CCTGTTACCTATTATACCACCATGT
>probe:Drosophila_2:1639762_at:88:129; Interrogation_Position=1273; Antisense; ACCACCATGTGTGCCGATTTATATG
>probe:Drosophila_2:1639762_at:693:61; Interrogation_Position=1373; Antisense; ATGTGGAAAACGTCTACCTCACCCA
>probe:Drosophila_2:1639762_at:53:643; Interrogation_Position=1431; Antisense; TCAGGACGAAACTCAGGCCACTATT
>probe:Drosophila_2:1639762_at:634:69; Interrogation_Position=1445; Antisense; AGGCCACTATTATTCCAGAGCATGC
>probe:Drosophila_2:1639762_at:598:419; Interrogation_Position=1462; Antisense; GAGCATGCCCATTGCAAGGACTTCA
>probe:Drosophila_2:1639762_at:452:557; Interrogation_Position=1479; Antisense; GGACTTCAATTCGATCAGCTCGAGT

Paste this into a BLAST search page for me
GAATGATCTTATTGGCGTTGCTGGAAGCGGTGGCAAGTGCTACGACCTTAATTACTGCATTACTTCTGGACACTAGCAACATTATGCGTCAGTGGATCTTAGTGGATCTTCCAGACCTGCAATGAGGTTGGTATCAGACCTCTGGTTCTAGGTTCTAGTGCCCAACCATTTGGTACCTGTTACCTATTATACCACCATGTACCACCATGTGTGCCGATTTATATGATGTGGAAAACGTCTACCTCACCCATCAGGACGAAACTCAGGCCACTATTAGGCCACTATTATTCCAGAGCATGCGAGCATGCCCATTGCAAGGACTTCAGGACTTCAATTCGATCAGCTCGAGT

Full Affymetrix probeset data:

Annotations for 1639762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720