Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639763_at:

>probe:Drosophila_2:1639763_at:496:225; Interrogation_Position=111; Antisense; AAGGCATGCTACAGTTCCAGCGCAA
>probe:Drosophila_2:1639763_at:627:321; Interrogation_Position=130; Antisense; GCGCAAAACCGGTGGACTCGGCCAA
>probe:Drosophila_2:1639763_at:475:245; Interrogation_Position=158; Antisense; AATTCCCAGTAACCTGCTCGAGGAT
>probe:Drosophila_2:1639763_at:535:637; Interrogation_Position=175; Antisense; TCGAGGATAAGCAAACGGCCGTTCT
>probe:Drosophila_2:1639763_at:487:197; Interrogation_Position=210; Antisense; AACGGTACGATCTTCGACAAGCGCC
>probe:Drosophila_2:1639763_at:645:179; Interrogation_Position=262; Antisense; AAACATACAGCTGGTGCCTGTGCGG
>probe:Drosophila_2:1639763_at:223:317; Interrogation_Position=277; Antisense; GCCTGTGCGGCAAGTCCAAGTCTCA
>probe:Drosophila_2:1639763_at:209:125; Interrogation_Position=301; Antisense; AGCCCCTCTGCGATGGAATGCACAA
>probe:Drosophila_2:1639763_at:14:115; Interrogation_Position=346; Antisense; AGCAGAGGCCCATTCGGTTCAAGGT
>probe:Drosophila_2:1639763_at:425:219; Interrogation_Position=375; Antisense; AAGTCGGGAGACTACTGGCTCTGCA
>probe:Drosophila_2:1639763_at:170:49; Interrogation_Position=456; Antisense; ATCCAGAGCGCCGTCAAATAGATTT
>probe:Drosophila_2:1639763_at:73:679; Interrogation_Position=480; Antisense; TAGGATTGGTTGTAGGGCCCTGCCC
>probe:Drosophila_2:1639763_at:398:577; Interrogation_Position=495; Antisense; GGCCCTGCCCGTGTGCGAAAAGAGA
>probe:Drosophila_2:1639763_at:475:525; Interrogation_Position=94; Antisense; GGGCATCCTGGTTGCTCAAGGCATG

Paste this into a BLAST search page for me
AAGGCATGCTACAGTTCCAGCGCAAGCGCAAAACCGGTGGACTCGGCCAAAATTCCCAGTAACCTGCTCGAGGATTCGAGGATAAGCAAACGGCCGTTCTAACGGTACGATCTTCGACAAGCGCCAAACATACAGCTGGTGCCTGTGCGGGCCTGTGCGGCAAGTCCAAGTCTCAAGCCCCTCTGCGATGGAATGCACAAAGCAGAGGCCCATTCGGTTCAAGGTAAGTCGGGAGACTACTGGCTCTGCAATCCAGAGCGCCGTCAAATAGATTTTAGGATTGGTTGTAGGGCCCTGCCCGGCCCTGCCCGTGTGCGAAAAGAGAGGGCATCCTGGTTGCTCAAGGCATG

Full Affymetrix probeset data:

Annotations for 1639763_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime