Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639764_at:

>probe:Drosophila_2:1639764_at:402:77; Interrogation_Position=4362; Antisense; AGGATCCAAAAGTAGCAATGCCCAA
>probe:Drosophila_2:1639764_at:664:317; Interrogation_Position=4381; Antisense; GCCCAAATGGCAACTTAAGGTATCG
>probe:Drosophila_2:1639764_at:349:221; Interrogation_Position=4397; Antisense; AAGGTATCGCCTTAAACATAACAAT
>probe:Drosophila_2:1639764_at:703:709; Interrogation_Position=4408; Antisense; TTAAACATAACAATCCGCAACGGGT
>probe:Drosophila_2:1639764_at:158:297; Interrogation_Position=4423; Antisense; CGCAACGGGTCTCAAGGTGTCAGTA
>probe:Drosophila_2:1639764_at:550:533; Interrogation_Position=4438; Antisense; GGTGTCAGTAGTTAATCCATTCGAT
>probe:Drosophila_2:1639764_at:173:235; Interrogation_Position=4451; Antisense; AATCCATTCGATTCCCAAGCATGAT
>probe:Drosophila_2:1639764_at:206:605; Interrogation_Position=4472; Antisense; TGATTGAGGCAATCTCCACCAGCTG
>probe:Drosophila_2:1639764_at:411:129; Interrogation_Position=4489; Antisense; ACCAGCTGGCTCTGTATTGGCCAAA
>probe:Drosophila_2:1639764_at:198:691; Interrogation_Position=4503; Antisense; TATTGGCCAAAGAGAAACGCTTCAC
>probe:Drosophila_2:1639764_at:445:391; Interrogation_Position=4516; Antisense; GAAACGCTTCACATCTAATGTTTAA
>probe:Drosophila_2:1639764_at:309:699; Interrogation_Position=4575; Antisense; TTTTTGCAAACGGTCATGTATTTCG
>probe:Drosophila_2:1639764_at:76:621; Interrogation_Position=4597; Antisense; TCGTATATTTACGAGCATCGTCATG
>probe:Drosophila_2:1639764_at:332:529; Interrogation_Position=4667; Antisense; GGGATAAGTTATCTTCAACGATGTT

Paste this into a BLAST search page for me
AGGATCCAAAAGTAGCAATGCCCAAGCCCAAATGGCAACTTAAGGTATCGAAGGTATCGCCTTAAACATAACAATTTAAACATAACAATCCGCAACGGGTCGCAACGGGTCTCAAGGTGTCAGTAGGTGTCAGTAGTTAATCCATTCGATAATCCATTCGATTCCCAAGCATGATTGATTGAGGCAATCTCCACCAGCTGACCAGCTGGCTCTGTATTGGCCAAATATTGGCCAAAGAGAAACGCTTCACGAAACGCTTCACATCTAATGTTTAATTTTTGCAAACGGTCATGTATTTCGTCGTATATTTACGAGCATCGTCATGGGGATAAGTTATCTTCAACGATGTT

Full Affymetrix probeset data:

Annotations for 1639764_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime