FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639766_at:

>probe:Drosophila_2:1639766_at:211:217; Interrogation_Position=1018; Antisense; AAGTTCGCCGAGAACGCTGCCGTCA
>probe:Drosophila_2:1639766_at:551:719; Interrogation_Position=1067; Antisense; TTCCCGATGGACACATGGGTCTGGA
>probe:Drosophila_2:1639766_at:526:641; Interrogation_Position=1086; Antisense; TCTGGATGTGGGTCCCAAGACCCGT
>probe:Drosophila_2:1639766_at:128:213; Interrogation_Position=1102; Antisense; AAGACCCGTGAGCTCTTCGCGGCAC
>probe:Drosophila_2:1639766_at:264:197; Interrogation_Position=1195; Antisense; AACGGCACCAAGTCCATCATGGACG
>probe:Drosophila_2:1639766_at:386:283; Interrogation_Position=1274; Antisense; CTGCCTCTTGCTGCGCCAAGTGGAA
>probe:Drosophila_2:1639766_at:683:585; Interrogation_Position=1346; Antisense; TGGAGCTCCTGGAGGGCAAGACACT
>probe:Drosophila_2:1639766_at:313:157; Interrogation_Position=1366; Antisense; ACACTGCCAGGCGTGGCTGCATTGA
>probe:Drosophila_2:1639766_at:531:5; Interrogation_Position=1386; Antisense; ATTGACCAGCGCCTAAGCGTACATA
>probe:Drosophila_2:1639766_at:381:655; Interrogation_Position=1429; Antisense; TAATCGCATCGTTTACCTTGTAAGC
>probe:Drosophila_2:1639766_at:96:725; Interrogation_Position=1446; Antisense; TTGTAAGCACAAACCACGACGTTAA
>probe:Drosophila_2:1639766_at:139:367; Interrogation_Position=1479; Antisense; GAATCTATTTGTTGCGGAACCATAT
>probe:Drosophila_2:1639766_at:341:661; Interrogation_Position=975; Antisense; TAACGTGCAGTTGCATCTGCCAGTG
>probe:Drosophila_2:1639766_at:639:267; Interrogation_Position=995; Antisense; CAGTGGACTTTGTCTGCGGCGACAA

Paste this into a BLAST search page for me
AAGTTCGCCGAGAACGCTGCCGTCATTCCCGATGGACACATGGGTCTGGATCTGGATGTGGGTCCCAAGACCCGTAAGACCCGTGAGCTCTTCGCGGCACAACGGCACCAAGTCCATCATGGACGCTGCCTCTTGCTGCGCCAAGTGGAATGGAGCTCCTGGAGGGCAAGACACTACACTGCCAGGCGTGGCTGCATTGAATTGACCAGCGCCTAAGCGTACATATAATCGCATCGTTTACCTTGTAAGCTTGTAAGCACAAACCACGACGTTAAGAATCTATTTGTTGCGGAACCATATTAACGTGCAGTTGCATCTGCCAGTGCAGTGGACTTTGTCTGCGGCGACAA

Full Affymetrix probeset data:

Annotations for 1639766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720