FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639767_at:

>probe:Drosophila_2:1639767_at:279:55; Interrogation_Position=3238; Antisense; ATGAACTTGCTCATCGGTTTGGCCG
>probe:Drosophila_2:1639767_at:332:727; Interrogation_Position=3256; Antisense; TTGGCCGTCGGCGATATTGAGTCAG
>probe:Drosophila_2:1639767_at:87:407; Interrogation_Position=3305; Antisense; GACTGGCCATGCAGGTGGTGCTCCA
>probe:Drosophila_2:1639767_at:350:359; Interrogation_Position=3416; Antisense; GCAAGCTGGGCTTCTGCGATTTCAT
>probe:Drosophila_2:1639767_at:407:293; Interrogation_Position=3432; Antisense; CGATTTCATCCTGCGCAAGTGGTTC
>probe:Drosophila_2:1639767_at:404:221; Interrogation_Position=3448; Antisense; AAGTGGTTCTCGAATCCATTCACCG
>probe:Drosophila_2:1639767_at:446:537; Interrogation_Position=3502; Antisense; GGTACTAGGTCCATCCAATACACTT
>probe:Drosophila_2:1639767_at:99:31; Interrogation_Position=3519; Antisense; ATACACTTTCAACTTCTATGCAGCC
>probe:Drosophila_2:1639767_at:526:585; Interrogation_Position=3638; Antisense; TGGAGCAACAGCACCATCTGGTTCG
>probe:Drosophila_2:1639767_at:190:41; Interrogation_Position=3653; Antisense; ATCTGGTTCGGCTCATTGTCCAAAA
>probe:Drosophila_2:1639767_at:94:531; Interrogation_Position=3714; Antisense; GGGTATATCCCCAAACGAGTTGCGA
>probe:Drosophila_2:1639767_at:210:47; Interrogation_Position=3738; Antisense; ATCCGTCGTCGGTTTGAGATCGGCA
>probe:Drosophila_2:1639767_at:268:395; Interrogation_Position=3767; Antisense; GAAATCGATGGAACTCGCCGCGAGT
>probe:Drosophila_2:1639767_at:164:417; Interrogation_Position=3806; Antisense; GAGCCGCCCTGAGCTTCAATAAGAG

Paste this into a BLAST search page for me
ATGAACTTGCTCATCGGTTTGGCCGTTGGCCGTCGGCGATATTGAGTCAGGACTGGCCATGCAGGTGGTGCTCCAGCAAGCTGGGCTTCTGCGATTTCATCGATTTCATCCTGCGCAAGTGGTTCAAGTGGTTCTCGAATCCATTCACCGGGTACTAGGTCCATCCAATACACTTATACACTTTCAACTTCTATGCAGCCTGGAGCAACAGCACCATCTGGTTCGATCTGGTTCGGCTCATTGTCCAAAAGGGTATATCCCCAAACGAGTTGCGAATCCGTCGTCGGTTTGAGATCGGCAGAAATCGATGGAACTCGCCGCGAGTGAGCCGCCCTGAGCTTCAATAAGAG

Full Affymetrix probeset data:

Annotations for 1639767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720