Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639768_at:

>probe:Drosophila_2:1639768_at:461:11; Interrogation_Position=1045; Antisense; ATATCGAATCTCTCCCACAATAAAG
>probe:Drosophila_2:1639768_at:445:609; Interrogation_Position=1076; Antisense; TGACGTCTTTTTGGCGCTTTAATAT
>probe:Drosophila_2:1639768_at:108:577; Interrogation_Position=513; Antisense; GGCGCTCCTTCAAGACAAGGCTATG
>probe:Drosophila_2:1639768_at:395:681; Interrogation_Position=534; Antisense; TATGGTGTCTGTTTAACCCTGCTCA
>probe:Drosophila_2:1639768_at:589:619; Interrogation_Position=553; Antisense; TGCTCACCGCACTATTAGGACTTGG
>probe:Drosophila_2:1639768_at:422:705; Interrogation_Position=567; Antisense; TTAGGACTTGGATCTTGGCTCATTC
>probe:Drosophila_2:1639768_at:21:317; Interrogation_Position=602; Antisense; GCCTCAAGAGCCTTTGCTATACCAA
>probe:Drosophila_2:1639768_at:585:165; Interrogation_Position=652; Antisense; AAACGAAGCCGTCCATAAGCTAAGT
>probe:Drosophila_2:1639768_at:629:485; Interrogation_Position=675; Antisense; GTAGATTCCACACTCCATTTAAAAC
>probe:Drosophila_2:1639768_at:179:257; Interrogation_Position=708; Antisense; CAAAGTGCCTTGACTCAGTTGGGAA
>probe:Drosophila_2:1639768_at:131:49; Interrogation_Position=736; Antisense; ATGCCATTTACTATCCTGATGCCTT
>probe:Drosophila_2:1639768_at:327:447; Interrogation_Position=753; Antisense; GATGCCTTGCGAAGCGAAGTTTCTT
>probe:Drosophila_2:1639768_at:260:559; Interrogation_Position=853; Antisense; GGACAGTTTTTATACTCGTGCATCA
>probe:Drosophila_2:1639768_at:593:363; Interrogation_Position=934; Antisense; GAATTGCATCCACGACATATCCTAG

Paste this into a BLAST search page for me
ATATCGAATCTCTCCCACAATAAAGTGACGTCTTTTTGGCGCTTTAATATGGCGCTCCTTCAAGACAAGGCTATGTATGGTGTCTGTTTAACCCTGCTCATGCTCACCGCACTATTAGGACTTGGTTAGGACTTGGATCTTGGCTCATTCGCCTCAAGAGCCTTTGCTATACCAAAAACGAAGCCGTCCATAAGCTAAGTGTAGATTCCACACTCCATTTAAAACCAAAGTGCCTTGACTCAGTTGGGAAATGCCATTTACTATCCTGATGCCTTGATGCCTTGCGAAGCGAAGTTTCTTGGACAGTTTTTATACTCGTGCATCAGAATTGCATCCACGACATATCCTAG

Full Affymetrix probeset data:

Annotations for 1639768_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime