FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639769_at:

>probe:Drosophila_2:1639769_at:70:39; Interrogation_Position=286; Antisense; ATCTGCGCCTACCTGGTGGAGAAGT
>probe:Drosophila_2:1639769_at:275:421; Interrogation_Position=322; Antisense; GAGCAGCAGCTCTATCCGAAGGAAT
>probe:Drosophila_2:1639769_at:724:707; Interrogation_Position=420; Antisense; TTACGAGCCCATCCTGTATTATGGA
>probe:Drosophila_2:1639769_at:187:481; Interrogation_Position=435; Antisense; GTATTATGGATCGACGGACTGCTCC
>probe:Drosophila_2:1639769_at:692:405; Interrogation_Position=451; Antisense; GACTGCTCCATCGACAAGATCGCAT
>probe:Drosophila_2:1639769_at:163:465; Interrogation_Position=506; Antisense; GATTCCTCAAGGATCAGCCGTATTT
>probe:Drosophila_2:1639769_at:61:125; Interrogation_Position=521; Antisense; AGCCGTATTTGTGTGGTTCTGATCT
>probe:Drosophila_2:1639769_at:1:607; Interrogation_Position=540; Antisense; TGATCTAACCATCGCAGACTTTTGC
>probe:Drosophila_2:1639769_at:315:261; Interrogation_Position=594; Antisense; CACCGCTCCCATCGATGAATTTAAG
>probe:Drosophila_2:1639769_at:523:709; Interrogation_Position=614; Antisense; TTAAGTTTCCCAAGATGCACGCCTG
>probe:Drosophila_2:1639769_at:720:287; Interrogation_Position=636; Antisense; CTGGCTGAAGCGTCTGGCAGAGCTA
>probe:Drosophila_2:1639769_at:650:417; Interrogation_Position=655; Antisense; GAGCTACCCTACTACCAGGAGGTAA
>probe:Drosophila_2:1639769_at:284:289; Interrogation_Position=749; Antisense; CGGCGGCTCTATTATGTTTTGTTTT
>probe:Drosophila_2:1639769_at:242:351; Interrogation_Position=839; Antisense; GCAGTTACAGCGACTTTGATCGATC

Paste this into a BLAST search page for me
ATCTGCGCCTACCTGGTGGAGAAGTGAGCAGCAGCTCTATCCGAAGGAATTTACGAGCCCATCCTGTATTATGGAGTATTATGGATCGACGGACTGCTCCGACTGCTCCATCGACAAGATCGCATGATTCCTCAAGGATCAGCCGTATTTAGCCGTATTTGTGTGGTTCTGATCTTGATCTAACCATCGCAGACTTTTGCCACCGCTCCCATCGATGAATTTAAGTTAAGTTTCCCAAGATGCACGCCTGCTGGCTGAAGCGTCTGGCAGAGCTAGAGCTACCCTACTACCAGGAGGTAACGGCGGCTCTATTATGTTTTGTTTTGCAGTTACAGCGACTTTGATCGATC

Full Affymetrix probeset data:

Annotations for 1639769_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720