FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639770_at:

>probe:Drosophila_2:1639770_at:470:311; Interrogation_Position=4577; Antisense; GCCAATGACGAGGATTAGTTTTCTT
>probe:Drosophila_2:1639770_at:332:477; Interrogation_Position=4594; Antisense; GTTTTCTTTATATTTCACCGAATTG
>probe:Drosophila_2:1639770_at:650:659; Interrogation_Position=4629; Antisense; TTATAACCTAACGACTACCGATATT
>probe:Drosophila_2:1639770_at:60:155; Interrogation_Position=4712; Antisense; AATCTTCTTGTATAATTCCCTAACG
>probe:Drosophila_2:1639770_at:133:59; Interrogation_Position=4743; Antisense; ATGATGAAGTGCTTGGCATGCCTAA
>probe:Drosophila_2:1639770_at:520:583; Interrogation_Position=4756; Antisense; TGGCATGCCTAAGTTAAGCTTTTTT
>probe:Drosophila_2:1639770_at:467:479; Interrogation_Position=4794; Antisense; GTTTCGGACTAAAATCTATGAGCAT
>probe:Drosophila_2:1639770_at:460:491; Interrogation_Position=4829; Antisense; GTAAGGACACGTATTCTCTTTAATT
>probe:Drosophila_2:1639770_at:27:17; Interrogation_Position=4878; Antisense; ATCTATCTGATTGTAACTTTTCCAC
>probe:Drosophila_2:1639770_at:432:563; Interrogation_Position=4917; Antisense; GGCACAACTGCATATGATTCTTTCG
>probe:Drosophila_2:1639770_at:286:11; Interrogation_Position=4933; Antisense; ATTCTTTCGATTCGTTGTCGGGCTA
>probe:Drosophila_2:1639770_at:674:569; Interrogation_Position=4953; Antisense; GGCTACGTTTTGTGAATCGTTTATA
>probe:Drosophila_2:1639770_at:27:411; Interrogation_Position=5035; Antisense; GACGAAAGCATTACACCAAAACATT
>probe:Drosophila_2:1639770_at:589:607; Interrogation_Position=5078; Antisense; TGAGGACTCTACCACATTGTTTTCT

Paste this into a BLAST search page for me
GCCAATGACGAGGATTAGTTTTCTTGTTTTCTTTATATTTCACCGAATTGTTATAACCTAACGACTACCGATATTAATCTTCTTGTATAATTCCCTAACGATGATGAAGTGCTTGGCATGCCTAATGGCATGCCTAAGTTAAGCTTTTTTGTTTCGGACTAAAATCTATGAGCATGTAAGGACACGTATTCTCTTTAATTATCTATCTGATTGTAACTTTTCCACGGCACAACTGCATATGATTCTTTCGATTCTTTCGATTCGTTGTCGGGCTAGGCTACGTTTTGTGAATCGTTTATAGACGAAAGCATTACACCAAAACATTTGAGGACTCTACCACATTGTTTTCT

Full Affymetrix probeset data:

Annotations for 1639770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720