FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639771_at:

>probe:Drosophila_2:1639771_at:416:195; Interrogation_Position=5278; Antisense; AACGTCCAAACGGAGACTGTGGCCA
>probe:Drosophila_2:1639771_at:645:359; Interrogation_Position=5303; Antisense; GCAAGATTGCCGTGCTGCTCAAGGA
>probe:Drosophila_2:1639771_at:372:621; Interrogation_Position=5315; Antisense; TGCTGCTCAAGGACGAACAGGCGCT
>probe:Drosophila_2:1639771_at:278:57; Interrogation_Position=5347; Antisense; ATGAGGGCAGCCACTGCTCTGGGTT
>probe:Drosophila_2:1639771_at:658:401; Interrogation_Position=5383; Antisense; GACATCTAGAGCATCCAAGGGACCA
>probe:Drosophila_2:1639771_at:544:221; Interrogation_Position=5398; Antisense; CAAGGGACCAACTCGATTAATTAGA
>probe:Drosophila_2:1639771_at:381:91; Interrogation_Position=5461; Antisense; AGTATTGCTCCAAGTGTGATCCCTT
>probe:Drosophila_2:1639771_at:597:221; Interrogation_Position=5472; Antisense; AAGTGTGATCCCTTTGCCTCAGCAA
>probe:Drosophila_2:1639771_at:1:281; Interrogation_Position=5489; Antisense; CTCAGCAATCGTTCCCTTATTATGT
>probe:Drosophila_2:1639771_at:490:233; Interrogation_Position=5611; Antisense; AATGCGGAGCGTTTTGCAGCTTTAA
>probe:Drosophila_2:1639771_at:507:677; Interrogation_Position=5651; Antisense; TAGGAACTCGTATTCGACCGAAGAC
>probe:Drosophila_2:1639771_at:729:411; Interrogation_Position=5666; Antisense; GACCGAAGACTTTGTTACGGACAAT
>probe:Drosophila_2:1639771_at:688:11; Interrogation_Position=5723; Antisense; ATTACCTTGGCTTTTTGAGGTTCAT
>probe:Drosophila_2:1639771_at:501:31; Interrogation_Position=5765; Antisense; ATAACTACTATGATTCCACAGCAAA

Paste this into a BLAST search page for me
AACGTCCAAACGGAGACTGTGGCCAGCAAGATTGCCGTGCTGCTCAAGGATGCTGCTCAAGGACGAACAGGCGCTATGAGGGCAGCCACTGCTCTGGGTTGACATCTAGAGCATCCAAGGGACCACAAGGGACCAACTCGATTAATTAGAAGTATTGCTCCAAGTGTGATCCCTTAAGTGTGATCCCTTTGCCTCAGCAACTCAGCAATCGTTCCCTTATTATGTAATGCGGAGCGTTTTGCAGCTTTAATAGGAACTCGTATTCGACCGAAGACGACCGAAGACTTTGTTACGGACAATATTACCTTGGCTTTTTGAGGTTCATATAACTACTATGATTCCACAGCAAA

Full Affymetrix probeset data:

Annotations for 1639771_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720